Informations

Les amorces pour PCR peuvent-elles être dupliquées ?


Complétez la question de débutant ici, ne riez pas : si j'ai des amorces qui ont été synthétisées et que je suis sur le point d'en manquer, y a-t-il un moyen de les dupliquer / de les amplifier / d'en synthétiser plus moi-même ? Je ne connais pas les séquences. Ou est ma seule option pour acheter plus ? Merci


Réponse courte : vous devez en acheter d'autres, mais vous avez également besoin de la séquence pour commander.

Réponse longue : La Taq polymérase a besoin d'un morceau d'ADN (ou d'ARN) pour amorcer la réaction et pouvoir agrandir la chaîne d'ADN, c'est pourquoi nous utilisons en premier lieu des amorces (également pour assurer la spécificité de la réaction à la région que nous voulons amplifier). Pour activer la réaction, vous auriez besoin d'un apprêt complémentaire à celui que vous avez utilisé d'environ la même longueur (ou du moins pas beaucoup plus court), donc cela n'a pas vraiment de sens, car vous devriez avoir un apprêt pour faire votre apprêt. Comme les apprêts sont bon marché aujourd'hui, commandez-en plus.


Enzymes Marines et Métabolisme Spécialisé - Partie A

Michael F. Freeman , dans Méthodes en Enzymologie , 2018

2.2.2 Tampons, solutions et réactifs

Plasmide pLMB51 (Addgène #40083)

Phusion ADN polymérase et tampon fourni

Désoxyribonucléotides (dNTP, 10 mM chaque)

Gel d'agarose TAE avec 0,5 μg/mL de bromure d'éthidium ou équivalent, tampon TAE (40 mM Tris, 20 mM acide acétique, 1 mM EDTA, pH 8,0)

Enzymes de restriction BamHI-HF, XbaI, BglII, SpeI-HF et tampons associés

E. coli souche de clonage telle que DH5α

Milieu de lysogénie (LB) et plaques de gélose LB avec 100 g/mL d'ampicilline (concentration finale)


Amorce de mutagenèse répétée dans la mutagenèse dirigée - (07 oct. 2013 )

J'essaie de créer une mutation ponctuelle dans le domaine du gène d'intérêt à l'aide du kit enzynomics EZ-MIX. Je crois que ce kit suit la méthode de mutagenèse dirigée par site à changement rapide. Amplification par PCR de l'amorce complémentaire à réserve directe avec l'introduction de la mutation au milieu de l'amorce, suivie de la digestion dpn1.

Je suis capable d'obtenir les colonies après transformation, mais lorsque j'ai envoyé deux clones pour le séquençage, le résultat du séquençage s'est avéré qu'il y avait une région répétée de l'amorce de mutagenèse entière dans les deux clones. Puis-je savoir si quelqu'un a vécu cela et comment surmonter ce problème. Je pense que l'envoi de plus de clones pour le séquençage peut aider. Merci !!

Je dois mentionner que je suis capable d'obtenir la mutation ponctuelle, mais toute la région de l'amorce s'est dupliquée. Merci!!

Voulez-vous dire que vous avez deux doublons de votre mutation dans votre gène ? J'ai du mal à comprendre ce que tu veux dire.

Je pense qu'il dit qu'il a la séquence complémentaire aux amorces de mutagenèse dupliquée dans son résultat. Y compris probablement la mutation qu'il voulait.

Je ne peux imaginer que de deux manières comment cela se produirait, la séquence près du site de mutation est très similaire et les amorces s'y lient, mais ce serait incompatible avec le processus de polymarération. L'autre est que les nouveaux brins sont en quelque sorte désalignés au niveau des sites d'entaille probablement parce que les extrémités sont complémentaires et ont dupliqué la séquence pendant la réparation du plasmide dans les cellules bactériennes.

Essayez certainement plus de clones. Mais si vous pouviez publier au moins des séquences d'amorces, il serait possible de dire si les amorces sont le problème.

Merci pour la réponse. Ci-joint les amorces que j'ai utilisées pour la mutagenèse dirigée. Le codon triple de couleur rouge est la mutation ponctuelle que j'ai introduite à la place de son codon triplet TAC d'origine. Je conçois l'amorce par moi-même et l'amorce n'est pas purifiée comme cela pourrait être nécessaire dans la mutagenèse dirigée.

5’- AAACAAATTTG TTG ATTGGGTTCTT

Cette amorce entière de 25 pb est dupliquée ou triplée dans les séquences des colonies après transformation. Par exemple, au lieu de flanquer-AAACAAATTTG TTG ATTGGGTTCTT-flanquant, maintenant il devient flanquant-AAACAAATTTG TTG ATTGGGTTCTTAAACAAATTTG TTG ATTGGGTTCTT-flancage. J'ai examiné plus de clones mais je n'ai pas pu trouver de clones normaux. Je ne sais pas si c'est dû à l'hybridation des amorces, car la région entière au lieu de la région partielle est dupliquée.

J'apprécierais si quelqu'un pouvait me donner des suggestions. Merci

C'est étrange que vous obteniez une insertion parfaite de l'amorce plusieurs fois. On peut voir la liaison des deux amorces lorsque vous les exécutez via un programme de prédiction de dimère, mais cela ne correspond pas à ce que vous voyez :

Thermo Scientific, Auto-dimères :

Les régions 5' et 3' de votre site d'insertion sont-elles similaires, ce qui permettrait des insertions multiples ?

Le kit de mutagenèse dit-il qu'une amorce de 25 pb est suffisante pour une mutation de 2 pb ? Mes protocoles nécessitaient généralement >40bp pour une mutation correcte.

Vos résultats sont pour le moins étranges.  Pourriez-vous fournir des informations sur la séquence de vos gènes 3' et 5' ?

Y a-t-il déjà eu une solution à ce problème ? De nouvelles idées ? Je viens d'effectuer une mutagenèse dirigée et je vis le même phénomène - la répétition d'une séquence contenant le mutant. 

Je ne pense pas qu'il y ait eu de résolution - mais il me semble qu'il pourrait y avoir une complémentation des amorces de l'OP qui pourrait potentiellement conduire à une duplication du site d'intérêt.

J'ai observé cela à plusieurs reprises. Je n'ai jamais trouvé de solution, autre que le dépistage de plus de colonies. Lorsque cela s'est produit, c'était généralement 1 colonie sur 5 que j'avais envoyée pour le séquençage. J'utilise une concentration d'apprêt beaucoup plus élevée que ce qui est recommandé. J'utilise environ 4-5 uM d'amorce dans la réaction, ce qui est beaucoup plus élevé que ma PCR normale. Si je devais deviner pourquoi cela se produit, je pense que la forte concentration d'apprêt peut provoquer ce résultat étrange.


Réaction en chaîne par polymérase (PCR) : Notes de biologie sur la PCR

La PCR fournit une méthode simple et ingénieuse d'amplification exponentielle de séquences d'ADN spécifiques par synthèse d'ADN in vitro, c'est-à-dire que cette technique a permis de synthétiser de grandes quantités de fragments d'ADN sans le cloner.

Kary Mulis a développé en 1985 la technique basée sur l'utilisation d'une enzyme appelée Taq ADN polymérase. La technique PCR est maintenant automatisée et est réalisée par une machine spécialement conçue.

La technique comprend les trois étapes suivantes (Fig. 22.16) :

je. Dénaturation du fragment d'ADN :

L'ADN cible contenant la séquence à amplifier est dénaturé thermiquement (environ 94°C pendant 15 secondes) pour séparer ses brins complémentaires, ce processus est appelé fusion de l'ADN cible.

ii. Recuit des amorces :

Des amorces sont ajoutées en excès et la température est abaissée à environ 68°C pendant 60 secondes, en conséquence les amorces forment les liaisons hydrogène et s'hybrident à l'ADN des deux côtés de la séquence d'ADN.

Enfin, différents nucléosides triphosphates (dATP, dGTP, dCTP, dTTP) et une ADN polymérase thermostable (Taq polymérase de Thermus aquaticus et Vent polymérase de Thermococcus litoralis) sont ajoutés au mélange réactionnel, cela aide au processus de polymérisation des amorces et, par conséquent , étend les amorces (à 68°C) entraînant la synthèse de plusieurs copies de la séquence d'ADN cible.

Après l'achèvement de toutes ces étapes dans un cycle, à nouveau le deuxième cycle est répété en suivant le même processus. Si 20 de ces cycles se produisent, alors environ un million de copies de la séquence d'ADN cible sont produites. Récemment, cette technologie a été beaucoup plus améliorée, où au lieu de la polymérase Taq, la polymérase rTth est utilisée qui transcrit l'ARN en ADN, puis amplifie l'ADN.

Formes modifiées de PCR :

La PCR conventionnelle est la technique de PCR symétrique. Il existe d'autres formes modifiées de PCR qui sont utilisées à diverses fins :

AP-PCR (Réaction en chaîne par polymérase amorcée arbitrairement) :

Il ne nécessite qu'une seule amorce de longueur relativement beaucoup plus petite par rapport aux amorces utilisées en PCR. Cette technique est utilisée pour le profilage ADN, en biotechnologie animale et végétale ainsi qu'en médecine légale.

Les séquences cibles d'un brin peuvent être amplifiées de plusieurs ordres de grandeur par rapport à son brin complémentaire. Cette approche est particulièrement utile pour générer un fragment d'ADN simple brin à utiliser pour le séquençage de l'ADN.

IPCR (Réaction en chaîne par polymérase inversée) :

Dans cette méthode, elle permet l'amplification de l'ADN flanquant une séquence d'ADN connue, les amorces sont tournées vers l'extérieur. En utilisant la PCR inverse, les séquences inconnues flanquant des séquences connues peuvent être facilement amplifiées.

RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) :

Bien que l'amplification PCR soit généralement réalisée sur la matrice d'ADN, mais en utilisant cette technique, l'ARN peut également être utilisé pour l'amplification. Cette technique est particulièrement utile pour étudier l'expression des gènes et pour surveiller les espèces obscures d'ARNm.

Les amorces PCR imbriquées sont celles qui sont internes à la première paire d'amorces. Les fragments plus gros produits par le premier cycle de PCR sont utilisés comme matrice pour la deuxième PCR. Cette technique élimine tous les produits d'amplification non spécifiques parasites.

Application de la PCR en biotechnologie :

La PCR a de nombreuses applications multiples.

1. L'amplification de fragments de gènes comme alternative rapide au clonage :

(a) Les inserts de plasmides bactériens peuvent être amplifiés avec des amorces.

(b) L'ADN d'une séquence connue peut être obtenu en concevant des amorces.

(c) La PCR aide à l'identification de séquences homologues d'organismes apparentés.

(d) En utilisant la RT-PCR, l'extrémité 3 & 8242 de l'ADNc peut être amplifiée (RACE : Rapid Amplification of cDNA Ends).

(e) La PCR inverse permet de connaître les séquences flanquantes d'un clone d'ADN connu.

2. Modification de fragments d'ADN :

La mutagenèse dirigée utilisant des oligonucléotides comme amorces PCR fournit une approche puissante pour étudier la relation structure-fonction.

3. Diagnostic du micro-organisme pathogène :

L'ADN des parties infectées d'une personne ou d'un animal peut être soumis à une PCR avec un gène spécifique d'amorce de l'agent pathogène et le diagnostic peut être effectué sur amplification de l'ADN.

4. Analyse ADN de spécimens archéologiques :

Comme l'ADN est relativement stable et reste intact pendant une longue période, la PCR peut aider à l'analyse de l'ADN à partir de ces matériaux intégrés.

5. Détection de mutations pertinentes pour les maladies héréditaires :

Toute mutation ponctuelle, une délétion ou une insertion et une répétition trinucléotidique en tandem expansée peuvent être détectées par PCR. Les mutations somatiques dans les oncogènes ou les gènes répresseurs de tumeurs peuvent également être détectées par PCR avec des amorces flanquant les insertions ou les délétions.

6. Analyse des marqueurs génétiques pour les applications médico-légales, pour les tests de paternité et pour la cartographie des caractères héréditaires.

(b) RAPD (Random Amplified Polymorphic DNA) avec des amorces arbitraires, souvent courtes (10 pb).

7. Amplification spécifique à l'espèce de segments d'ADN entre des éléments répétés intercalés (IRS) à l'aide de l'amorce basée sur la séquence SINE (Short Interspersed Nuclear Elements).

8. Génie génétique par PCR :

En utilisant la PCR, nous pouvons incorporer une altération ou une mutation dans le produit final en modifiant, en supprimant ou en ajoutant au choix des séquences à l'amorce à l'extrémité 5 & 8242. Par la technique de PCR recombinante, il est possible de joindre deux fragments d'ADN à un site spécifique par des chevauchements complémentaires (cette technique est appelée épissage). En synthétisant deux amorces mutagènes, couvrant le site interne à modifier, il est possible d'introduire des mutations au sein d'un fragment.


Préparation de l'ADN

Le clonage moléculaire consiste à introduire de l'ADN, sous forme d'insert, dans une molécule vectrice. L'ADN à cloner peut être obtenu en le coupant d'un ADN source par digestion avec des enzymes de restriction, en le copiant à partir d'une molécule source soit par Polymerase Chain Reaction (PCR) soit par Reverse Transcription-PCR (RT-PCR), soit en l'assemblant à partir de courts morceaux d'ADN (oligonucléotides). Ces méthodes nécessitent toutes que la source d'ADN soit suffisamment exempte de contaminants qui pourraient potentiellement inhiber les activités enzymatiques (endonucléases, polymérases) impliquées dans le traitement de l'ADN pour le clonage.


Le clonage traditionnel par digestion par endonucléase de restriction peut utiliser n'importe quel type d'ADN source différent. L'ADN génomique peut être digéré avec une enzyme de restriction et cloné dans un site de vecteur compatible pour produire une bibliothèque de différents inserts, tous à partir du même ADN source. L'ADN déjà cloné dans un vecteur peut être transféré (sous-cloné) vers un nouveau vecteur receveur en coupant l'ADN avec des enzymes de restriction et en le clonant dans les sites correspondants du second vecteur. Ceci est fréquemment entrepris pour faciliter l'expression des protéines ou la transcription de l'ARN, par exemple, ce qui pourrait ne pas être possible à partir du vecteur d'origine.

La PCR est souvent utilisée pour générer de l'ADN pour le clonage et fréquemment des sites de restriction sont incorporés dans les sites d'amorce de sorte que l'ADN amplifié puisse être digéré et cloné dans des sites de restriction compatibles du vecteur de clonage. Tout type d'ADN contenant la séquence souhaitée peut servir de matrice pour la PCR. Le clonage avec deux enzymes de restriction distinctes garantit que des extrémités non compatibles sont générées sur chaque molécule, empêchant ainsi une simple recircularisation du vecteur et forçant les inserts à être clonés de manière directionnelle. Cela peut être important pour assurer un cadre de lecture ouvert traductionnel pour l'expression des protéines. La modification des extrémités de l'ADN après digestion par restriction peut être utile dans certaines situations. Par exemple, dans le clonage non directionnel, où une seule enzyme de restriction est utilisée, la déphosphorylation de l'ADN vecteur digéré empêchera la recircularisation du vecteur, augmentant ainsi la proportion des molécules d'ADN recombinant souhaitées.

La PCR est de plus en plus utilisée pour préparer l'ADN pour des applications de clonage. L'ADN amplifié peut être soit cloné directement, soit après digestion par restriction avec des sites de restriction conçus dans les amorces utilisées pour la PCR. Alternativement, l'ADN amplifié peut être utilisé dans des stratégies de clonage sans couture telles que NEBuilder HiFi DNA Assembly ou dans le clonage indépendant par ligature. Les molécules vectrices pour ces méthodes de clonage peuvent également être produites par PCR. L'ADN amplifié avec la polymérase Taq a une adénosine unique indépendante de la matrice (A) ajoutée aux extrémités 3&rsquo qui permet le clonage dans des vecteurs à queue T complémentaires. Les polymérases de relecture haute fidélité n'ajoutent pas de bases supplémentaires permettant le clonage de l'ADN amplifié dans des sites de restriction à extrémités franches. Selon la stratégie de clonage choisie, les extrémités de l'ADN amplifié peuvent être modifiées par une queue A, un émoussement, ou l'ajout ou la suppression de groupes 5 & rsquo-phosphate. L'ADN complémentaire (ADNc) généré par transcription inverse d'ARN peut également être amplifié par PCR. Cette capacité à synthétiser de l'ADN à partir de matrices d'ARN permet le clonage de séquences correspondant à des transcrits de gènes.


PROCÉDURES EXPÉRIMENTALES

Compétences prélaboratoires—

Pour réussir cet exercice, les compétences techniques suivantes sont requises : technique de laboratoire stérile, capacité de pipetage précis, connaissance des techniques de préservation de l'activité enzymatique et utilisation de microcentrifugeuses et de papier semi-logarithmique. La connaissance de la réplication de l'ADN, de la PCR et de l'électrophorèse sur gel d'agarose est utile, mais peut être fournie lors d'une conférence préparatoire avant l'exercice de laboratoire. Les étudiants travaillent en groupes de deux ou trois, au moins un membre du groupe doit être un homme et un doit être une femme.

Équipement-

L'exercice de laboratoire nécessite une microcentrifugeuse, deux bains-marie chauffants, un équipement d'électrophorèse sur gel (alimentations électriques, boîtes de gel horizontales, plateaux et peignes) et un ou plusieurs thermocycleurs d'une capacité suffisante pour accueillir le nombre de groupes d'étudiants. Une source de lumière ultraviolette avec un écran de protection contre les ultraviolets est nécessaire pour visualiser les bandes d'ADN. Si disponible, un appareil de documentation du gel ou une caméra peut être utilisé pour produire une image du gel. Pour les expériences décrites ici, le thermocycleur Mastercycler Gradient et la microcentrifugeuse 5415C (Eppendorf, Hambourg, Allemagne), le système d'électrophorèse sur gel Mini-Sub Cell GT PowerPac 300 (n° de catalogue 165-4347 Bio-Rad, Hercules, CA), et IS- 1000 Digital Imaging System (Alpha Innotech Corp., San Leandro, CA) ont été utilisés.

Kits, enzymes et solutions—

Le kit d'isolement d'ADN génomique (n° de catalogue SA-40001) et le kit d'ensemble d'amorces chromosomiques X&Y (n° de catalogue SP-10704) ont été achetés auprès de Maxim Biotech. Le kit d'amorces fournit les deux amorces, un tampon PCR avec des nucléotides, une échelle d'ADN de 100 pb et de l'ADN humain à utiliser comme contrôle positif. Théoriquement, chaque kit contient suffisamment de matériel pour 100 dosages (33 groupes). Cependant, étant donné qu'un excès de solution est fourni à chaque groupe, un kit peut contenir 20 à 24 séries de trois PCR, y compris le prétest de l'expérience. La quantité d'échelle d'ADN de 100 pb dans le kit peut être limitée, mais une échelle d'ADN supplémentaire peut être achetée séparément auprès de la société. La polymérase Taq (5 U/ul) a été obtenue auprès d'Eppendorf. Le tampon de chargement d'échantillons d'ADN peut être acheté (n° de catalogue 161-0767 Bio-Rad) ou préparé selon les protocoles standard [ 9 ]. L'agarose (SeaKem GTG) a été obtenu auprès de BioWhittaker Molecular Applications (Rockland, ME). Le bromure d'éthidium (un mutagène) a été acheté sous forme de solution à 10 mg/ml (Bio-Rad), et la solution concentrée n'a été manipulée que par l'instructeur ou l'assistant d'enseignement portant des gants appropriés. Les élèves ont été autorisés à manipuler des solutions diluées de bromure d'éthidium en utilisant des gants avec des avertissements sur ses propriétés mutagènes. D'autres colorants d'ADN aux propriétés apparemment moins nocives sont disponibles (colorant d'acide nucléique Gelstar FMC, Philadelphie, PA).

Fournitures et installation de laboratoire—

Pour chaque groupe, les fournitures suivantes sont nécessaires : des gants pour manipuler les solutions au bromure d'éthidium, des pipettes et des embouts de pipettes stériles pour des volumes de 2 à 1000 l, quatre microtubes stériles de 1,5 ml pour isoler l'ADN, deux embouts de pipettes stériles de 1 ml ( ou deux écouvillons stériles) pour le prélèvement d'échantillons de cellules de la joue, trois tubes PCR de 0,5 ml et trois tubes de microcentrifugation stériles de 0,5 ml pour la préparation d'échantillons d'électrophorèse.

Étant donné que les étudiants ont souvent une expérience limitée du pipetage et de la manipulation des enzymes actives, il peut être avantageux de fournir aux groupes individuels des aliquotes des différentes solutions utilisées dans la procédure. Dans nos laboratoires, il était également avantageux de faire ajouter les enzymes soit par l'assistant d'enseignement, soit par l'instructeur. Sans ces précautions, les erreurs de pipetage des étudiants ont parfois entraîné des pertes importantes d'enzymes coûteuses dans les conteneurs de stockage. Alternativement, la Taq polymérase peut être mélangée avec le tampon PCR optimisé juste avant la période de laboratoire et fournie sous forme de mélange tampon PCR/polymérase (0,2 l de Taq polymérase pour 30 l de tampon PCR).

Fournissez à chaque groupe d'élèves un seau à glace contenant des aliquotes séparées de composants étiquetés (1,2 à 2 fois le volume spécifié dans le protocole). Les solutions et volumes indiqués ci-dessous s'appliquent au kit de purification d'ADN génomique Maxim Biotech. D'autres kits peuvent également être utilisés. Pour l'isolement de l'ADN (jour 1), aliquoter la solution de lyse cellulaire (1,5 ml de solution BD-3), la ribonucléase A (25 l sur glace), la solution de précipitation des protéines (0,5 ml de solution BD-4 sur glace) et 100 % d'éthanol (1,5 ml à température ambiante).

Pour le jour 2, fournissez de l'éthanol à 70 % glacé (2,5 à 3 ml), de l'eau distillée stérile et désionisée (0,5 ml), des amorces du kit d'amorces X&Y (40 l), de l'ADN génomique humain dilué 10 fois (15 l ), et le mélange tampon PCR/polymérase (120 l). Pour l'électrophorèse sur gel d'agarose (jour 3), fournir 5 × tampon d'échantillon d'acide nucléique (15 l) et Tris-acétate-EDTA (TAE)12 2 L'abréviation utilisée est : TAE, Tris-acétate-EDTA. tampon d'électrophorèse (300 ml de Tris acétate 40 mM, EDTA 1 mM). En outre, prémélangez 20 ul de tampon d'échantillon avec 100 ul d'échelle d'ADN de 100 pb et aliquotez 6 ul à chaque groupe. Pour minimiser l'exposition des étudiants aux solutions concentrées de bromure d'éthidium, l'assistant pédagogique peut faire fondre l'agarose (1% dans le tampon TAE) juste avant la période de laboratoire, placer des aliquotes de 50 ml dans des tubes jetables de 50 ml résistants à la chaleur, ajouter du bromure d'éthidium, et conserver les tubes dans un bain-marie à 65 °C jusqu'à utilisation.

Les préoccupations de sécurité-

Le bromure d'éthidium et certains autres colorants d'ADN sont mutagènes. Portez des gants et évitez tout contact avec ces substances. Éliminez correctement les pointes de pipette qui entrent en contact avec le bromure d'éthidium concentré. Autoclavez tous les échantillons biologiques à la fin de l'exercice et éliminez-les conformément à la politique de santé et de sécurité environnementales de chaque campus.

Procédures expérimentales-

Les instructions du fabricant pour le kit d'isolement d'ADN génomique ont été fournies aux étudiants, et la procédure est résumée ci-dessous. Préparez des échantillons d'ADN masculins et féminins séparés. Grattez doucement l'intérieur des deux joues 10 fois avec un embout de pipette stérile de 1 ml ou un écouvillon stérile. De la matière solide et de la salive doivent être visibles dans la pointe de la pipette. Mélanger soigneusement l'échantillon avec 0,6 ml de solution froide de BD-3 (solution de lyse) dans un tube de microcentrifugation stérile de 1,5 ml. La solution de lyse contient un détergent et une base forte pour rompre la membrane cellulaire et libérer le contenu cellulaire. Homogénéiser l'échantillon en mélangeant puis incuber à 65 °C pendant 30 min. Refroidir la solution à température ambiante et ajouter 10 ul de solution de RNase A pour digérer les molécules d'ARN présentes dans l'échantillon. Incuber à 37 ° C pendant 20 min, puis placer le tube sur de la glace pendant 5 min. Ajouter 0,2 ml de solution de BD-4, qui contient un sel qui provoque la précipitation des protéines par effet de relargage. Bien mélanger en retournant le tube plusieurs fois et centrifuger pendant 10 min dans une microcentrifugeuse à vitesse maximale pour éliminer les protéines précipitées. Recueillir le surnageant contenant l'ADN et transférer dans un nouveau tube de microcentrifugation de 1,5 ml. Ajouter 0,6 ml d'éthanol à 100 % à température ambiante et inverser le tube 40 à 50 fois pour précipiter l'ADN. Conserver les tubes à centrifuger à 4 °C jusqu'à la prochaine période de laboratoire.

Achèvement de l'isolement de l'ADN et préparation des mélanges PCR—

Pour terminer l'isolement de l'ADN, centrifuger les tubes à vitesse maximale pendant 10 min et jeter le surnageant. L'ADN devrait précipiter, mais dans la plupart des cas, il ne sera pas visible. Pipeter doucement 1 ml d'éthanol à 70 % glacé dans le tube pour laver l'ADN. Ne pas mélanger le contenu du tube. Centrifuger pendant 5 min, jeter le surnageant et laisser le culot sécher à l'air. Ajouter 0,2 ml d'eau déminéralisée distillée stérile. Chauffer le tube à 65 ° C pendant 20 min, en inversant le tube plusieurs fois pendant l'incubation pour dissoudre l'ADN. Si nécessaire, l'échantillon d'ADN peut être conservé à -20 °C, mais ne doit pas être congelé et décongelé à plusieurs reprises.

Électrophorèse sur gel d'agarose—

Fournir des instructions et du matériel pour permettre aux élèves de préparer des gels d'agarose horizontaux à 1 % (7 × 10 cm) dans un tampon TAE. Placer les gels dans les boîtes de gel avec du tampon TAE. Étiquetez trois tubes de microcentrifugation stériles comme ADN femelle, mâle ou de contrôle. Ajouter 3 ul de tampon d'échantillon 5 × dans chaque tube. À l'aide d'un embout frais pour chaque tube, ajoutez 15 ul de chaque PCR dans le tube de microcentrifugeuse étiqueté de manière appropriée. Mélangez brièvement. Chargez 15 ul de chaque mélange dans une voie séparée sur le gel. Dans la quatrième voie, ajoutez 5 ul d'échelle d'ADN (norme de taille moléculaire) prémélangée avec un tampon de chargement d'échantillon d'ADN. Fixez le couvercle sur la boîte de gel et exécutez le gel jusqu'à ce que le colorant bleu plus foncé atteigne la moitié aux deux tiers de la longueur du gel (généralement 45 min à 100 V). Coupez l'alimentation, retirez le gel et enregistrez le motif de bandes observé avec la lumière ultraviolette.


CONCEPTION AMORCES PCR

INFORMATIONS D'ARRIÈRE-PLAN: Pour les sites décrivant la théorie de la PCR, ainsi que les entreprises commercialisant des produits PCR, vous pouvez commencer par visiter Highveld. Pour les techniques de PCR, voir PCRlink.com.

Il existe plusieurs excellents sites pour concevoir des amorces PCR :

Primer3 : outil d'amorce WWW (École de médecine de l'Université du Massachusetts, États-Unis) &ndash Ce site dispose d'un programme de conception d'amorces PCR très puissant permettant un contrôle considérable sur la nature des amorces, y compris la taille du produit souhaité, la taille de l'amorce et la plage de Tm, et la présence/absence d'une pince 3&rsquo-GC.
GeneFisher - Conception d'amorces PCR interactives (Université de Bielefeld, Allemagne) - un très bon site permettant une grande maîtrise de la conception des amorces.

Primer3Plus - une nouvelle interface Web améliorée pour le programme de conception d'amorces populaire Primer3 (Référence : A. Untergasser et al. 2007. Nucl. Acids Res. 35(Problème de serveur Web) : W71-W74)
Outil de conception et de recherche d'amorces BiSearch - il s'agit d'un outil utile pour la conception d'amorces pour n'importe quelle matrice d'ADN et en particulier pour les génomes traités au bisulfite. L'outil ePCR permet une détection rapide des sites d'amorçage erroné et des produits de PCR alternatifs dans les bibliothèques d'ADNc et les génomes natifs ou traités au bisulfite. (Référence : Arányi T et al. 2006. BMC Bioinformatics 7: 431).

Primer-BLAST a été développé au NCBI pour aider les utilisateurs à créer des amorces spécifiques au modèle PCR d'entrée. Il utilise Primer3 pour concevoir des amorces PCR, puis les soumet à la recherche BLAST par rapport à la base de données sélectionnée par l'utilisateur. Les résultats de l'explosion sont ensuite automatiquement analysés pour éviter les paires d'amorces qui peuvent provoquer l'amplification de cibles autres que la matrice d'entrée.

MFEprimer permet aux utilisateurs de vérifier rapidement et facilement la spécificité de l'amorce par rapport à l'ADN génomique et aux bases de données de séquences d'ADN génomique et d'ARN messager/séquence d'ADN complémentaire. Ce serveur utilise un algorithme d'index k-mer pour accélérer le processus de recherche de sites de liaison d'amorce et utilise la thermodynamique pour évaluer la stabilité de liaison entre chaque amorce et sa matrice d'ADN. Plusieurs caractéristiques importantes, telles que la séquence, la température de fusion et la taille de chaque amplicon, spécifique ou non spécifique, sont rapportées. (Référence : Qu W et al. 2012. Nucl. Acids Res. 40 (Problème de serveur Web) : W205-W208)

Outil de conception et de recherche d'amorces

PrimerDesign-M - comprend plusieurs options pour la conception d'amorces multiples, permettant aux chercheurs de concevoir efficacement des amorces de marche qui couvrent de longues cibles d'ADN, telles que des génomes entiers du VIH-1, et qui optimisent les amorces simultanément informées par la diversité génétique dans plusieurs alignements et les contraintes de conception expérimentale donné par l'utilisateur. PrimerDesign-M peut également concevoir des amorces qui incluent des codes-barres ADN et minimisent la dimérisation des amorces. PrimerDesign-M trouve des amorces optimales pour des cibles d'ADN très variables et facilite la flexibilité de conception en suggérant des conceptions alternatives pour s'adapter aux conditions expérimentales. (Référence : Yoon H & Leitner T. 2015. Bioinformatique 31:1472-1474).

Clonage RF (clonage sans restriction) - est une technologie basée sur la PCR qui étend le processus de mutagenèse QuikChange&trade popularisé à l'origine par Stratagene au milieu des années 1990, et permet l'insertion de pratiquement n'importe quelle séquence dans n'importe quel plasmide à n'importe quel endroit. (Référence : Bond SR & Naus CC. 2012. Nucl. Acids Res 40(Problème de serveur Web) : W209-W213)

primers4clades - est un pipeline pour la conception d'amorces PCR pour l'amplification inter-espèces de nouvelles séquences à partir d'ADN métagénomique ou d'organismes non caractérisés appartenant à des lignées phylogénétiques spécifiées par l'utilisateur. Il met en œuvre une stratégie CODEHOP étendue basée sur des alignements multiples d'ADN et de protéines de gènes codants et évalue les propriétés thermodynamiques des paires d'oligonucléotides, ainsi que le contenu en information phylogénétique des amplicons prédits, calculé à partir des valeurs de support de branche des phylogénies de vraisemblance maximale. Les arbres affichés à l'écran facilitent le ciblage des amorces vers des clades sélectionnés de manière interactive. (Référence : Contreras-Moreira B et al. 2009. Nucleic Acids Res. 37(Problème de serveur Web) : W95-W100).

TaxMan : inspectez vos amplicons d'ARNr et vos attributions de taxons - Dans les analyses de microbiome, les bases de données de gènes d'ARNr sont souvent utilisées pour attribuer des noms taxonomiques aux lectures de séquences. Le serveur TaxMan facilite l'analyse de la répartition taxonomique de vos lectures de deux manières. Tout d'abord, vous pouvez vérifier quels noms taxonomiques sont attribués aux séquences produites par vos amorces et quels taxons vous perdrez. Deuxièmement, les séquences d'amplicons produites avec des lignées dans l'en-tête FASTA peuvent être téléchargées. Cela peut entraîner une analyse beaucoup plus efficace en ce qui concerne le temps d'exécution et l'utilisation de la mémoire, car les séquences d'amplicons sont considérablement plus courtes que les séquences de gènes d'ARNr pleine longueur. De plus, vous pouvez télécharger un fichier de lignée qui comprend les dénombrements de tous les taxons pour vos amorces et pour la référence utilisée. (Référence : Brandt, B.W. et al. 2012. Nucleic Acids Research 40:W82-W87).

Paramètres physico-chimiques des oligonucléotides :

NetPrimer (Premier Biosoft International, États-Unis) - À mon avis, le meilleur site car il en fournit un avec Tm, des propriétés thermodynamiques et des dimères en épingle à cheveux et ampli les plus stables. MAIS il faut un certain temps pour que le programme se charge.

dnaMATE - calcule un consensus Tm pour une séquence d'ADN courte (16-30 nts) en utilisant une méthode fusionnée basée sur trois tables thermodynamiques différentes. La valeur de consensus Tm est une estimation robuste et précise de la température de fusion pour de courtes séquences d'ADN d'application pratique en biologie moléculaire. Les références de précision utilisant toutes les données expérimentales disponibles indiquent que les erreurs de prédiction de consensus Tm seront à moins de 5 ºC de la valeur expérimentale dans 89% des cas. (Référence : A. Panjkovich et al. 2005. Nucl. Acides Rés. 33: W570-W572.).

OligoCalc - un calculateur de propriétés d'oligonucléotides en ligne - ( Référence : W.A. Kibbe. 2007. Nucl. Acids Res. 35 (Web Server issue) : W43-W46)
OligoAnalyzer 3.1 (Integrated DNA Technologies, Inc )
Calculateur de masse Mongo Oligo v2.06
OligoEvaluateur (Sigma-Aldrich)
Outil de calcul Oligo (Genescript, États-Unis) - permet de modifier

Amorces PCR basées sur la séquence protéique :

Si vous avez la séquence de protéines et que vous voulez la séquence d'ADN, les meilleurs sites sont la traduction inverse de protéine en ADN ou la partie traduction inverse de la suite de manipulation de séquence. Si vous souhaitez changer un acide aminé spécifique en un autre, vous devriez consulter Primaclade (Référence : Gadberry MD et al. 2005. Bioinformatique 21:1263-1264).

PCR et clonage :

AMUSEUR (UNEADN automatisé Modifications avec UTILISATEUR clonage) offre une conception rapide et facile d'amorces PCR optimisées pour diverses ingénieries d'ADN basées sur le clonage d'UTILISATEURS. Le clonage USER est une méthode rapide et polyvalente pour l'ingénierie de l'ADN plasmidique. Cet outil de serveur Web automatise la conception d'amorces PCR optimales pour plusieurs applications distinctes basées sur le clonage USER. Il facilite l'assemblage d'ADN et l'introduction de pratiquement tout type de mutagenèse dirigée en concevant des amorces PCR optimales pour les changements génétiques souhaités. (Référence : Genee HJ et al. 2015. ACS Synth Biol. 4:342-349).

Amorces à l'échelle génomique : (N.B. voir aussi la page JAVA pour des programmes téléchargeables supplémentaires)

La suite PCR (Klinische Genetica, Erasmus MC Rotterdam, Pays-Bas) - il s'agit d'une suite de quatre programmes basés sur Primer3 pour la conception d'amorces génomiques. Tous offrent un contrôle considérable sur les propriétés des apprêts :

Overlapping_Primers - crée plusieurs produits PCR qui se chevauchent en une seule séquence.
Genomic_Primers - conçoit des amorces autour des exons dans la séquence génomique. Tout ce dont vous avez besoin est un fichier GenBank contenant votre gène.
SNP_Primers - conçoit des amorces autour de chaque SNP dans un fichier GenBank.
cDNA_Primers - conçoit des amorces autour de cadres de lecture ouverts. Téléchargez simplement un fichier GenBank contenant vos gènes.

Jeux d'amorces superposés :

Deux sites proposent un logiciel basé sur le programme Primer3 pour la conception de jeux de paires d'amorces PCR qui se chevauchent - Conception d'amorces multiples avec Primer 3 et jeux d'amorces superposés

PHUSER (Primeur Haide pour UTILISATEUR ) - La fusion Uracil-Specific Exision Reagent (USER) est une technique récemment développée qui permet l'assemblage de plusieurs fragments d'ADN en quelques étapes simples. PHUSER offre une conception rapide et facile d'amorces optimisées pour la PCR assurant une fusion directionnelle correcte des fragments dans un plasmide contenant une cassette USER personnalisable. Les amorces ont une température de recuit (Tm) similaire. PHUSER évite également les surplombs identiques, assurant ainsi un ordre correct d'assemblage des fragments d'ADN. Toutes les amorces possibles sont analysées individuellement en termes de contenu GC, de présence de pince GC à l'extrémité 3 & 39, de risque de formation de dimères d'amorces, de risque de structures secondaires intra-amorces et de présence d'étirements polyN. (Référence : Olsen LR et al. 2011. Nucl. Acids Res. 39 (Problème de serveur Web) : W61-W70)

Primerize est un serveur Web pour la conception d'amorces d'assemblage PCR de séquences d'ADN. Primerize est optimisé pour réduire les erreurs d'amorçage des limites des amorces, est conçu pour des séquences fixes de problèmes d'ARN et a réussi des tests larges et rigoureux. Cet algorithme efficace est adapté à une utilisation étendue telle que la bibliothèque de mutagenèse massivement parallèle. (Référence : Tian, ​​S., & Das, R. (2016) Revue trimestrielle de biophysique 49(e7) : 1-30).

Conception d'ARN interférent court (siARN) :

Les petits ARN interférents (ARNsi) guident la dégradation spécifique à la séquence de l'ARNm homologue, produisant ainsi des cellules « knock-down ». L'outil de conception de siRNA scanne un gène cible pour les séquences de siRNA candidates qui satisfont aux règles réglables par l'utilisateur. Une variété de serveurs existe :

Logiciel de conception siRNA - compare les outils de conception existants, y compris ceux énumérés ci-dessus. Ils tentent également d'améliorer les principes MPI et les outils existants par un algorithme capable de filtrer les siRNA inefficaces. L'algorithme est basé sur de nouvelles observations sur la structure secondaire. ( Référence: S.M. Yiu et al. (2004) Bioinformatique 21: 144-151).

OligoWalk est un serveur en ligne calculant les caractéristiques thermodynamiques de l'hybridation sens-antisens. Il prédit les changements d'énergie libre des oligonucléotides se liant à un ARN cible. Il peut être utilisé pour concevoir un ARNsi efficace ciblant une séquence d'ARNm donnée. (Référence : Lu ZJ & Mathews DH. 2008. Nucl. Acids Res. 36: 640-647).

VIRsiRNApred - un serveur de prédiction de l'efficacité du siRNA viral humain (Référence : Qureshi A et al. 2013. J Transl Med. 11:305).

Les siRNA à substrat Dicer (DsiRNA) sont des ARN duplex 27-mères synthétisés chimiquement qui ont une puissance accrue en interférence ARN par rapport aux siRNA traditionnels. RNAi DESIGN (IDT Integrated DNA Technologies)

pssRNAit - Concevoir des siRNA d'ARNi de plantes efficaces et spécifiques avec une évaluation des gènes hors cible à l'échelle du génome.

DSIR est un outil pour la conception de cibles siRNA (19 ou 21 nt) et shRNA. (Référence : Vert JP et al. 2006. BMC Bioinformatics 7:520).

Le programme Imgenex siRNA retriever a été conçu pour sélectionner des oligonucléotides d'ADN codant pour les siRNA qui peuvent être clonés dans l'un des vecteurs pSuppressor. La séquence d'entrée est directement accessible à partir d'une accession ou d'une séquence Genbank fournie par le chercheur.

siDRM est une implémentation des ensembles de règles DRM pour sélectionner des siARN efficaces. Les auteurs ont effectué une analyse mise à jour en utilisant l'approche de fusion de règles disjonctives (DRM) sur un ensemble de données volumineux et diversifié compilé à partir de siRecords, et ont implémenté les ensembles de règles résultants dans siDRM, un nouvel outil de conception de siRNA en ligne. siDRM implémente également quelques ensembles de règles à haute sensibilité et des ensembles de règles rapides, des liens vers siRecords, et utilise plusieurs filtres pour vérifier les effets néfastes indésirables, y compris les réponses immunitaires innées, les effets toxiques cellulaires et les activités hors cible dans la sélection des siARN. (Référence : Gong W et al. 2008. Bioinformatique 24:2405-2406).

Outil de conception d'ARNsi siMAX (Eurofins Genomic, Allemagne) - est un logiciel développé propriétaire conçu pour vous aider à sélectionner le siRNA le plus approprié ciblant votre (vos) gène(s) d'intérêt.

Concepteur shRNA (Biosettia Inc., États-Unis) - Utilisez ce programme pour concevoir des oligos shRNA compatibles avec nos vecteurs SORT-A/B/C. L'outil de conception fournit aux cibles les plus grandes chances d'abattre votre gène. Veuillez noter qu'un seul oligo est conçu car il est palindrome.

Centre siDESIGN (Horizon Discovery Ltd., Royaume-Uni) - est un outil de conception d'ARNsi avancé et convivial, qui améliore considérablement la probabilité d'identifier l'ARNsi fonctionnel. Des options uniques sont disponibles pour améliorer la spécificité de la cible et adapter les conceptions d'ARNsi pour une conception expérimentale plus sophistiquée.

Conception d'amorces PCR en temps réel :

Conception en temps réel (Technologies de recherche biologique) - gratuit mais sur inscription.

GenScript Real-time PCR (TaqMan) Primer Design - on peut personnaliser la plage de taille potentielle de l'amplicon PCR, Tm (température de fusion) pour les amorces et les sondes, ainsi que l'organisme. Vous pouvez également décider du nombre de jeux d'amorces/sondes que vous souhaitez que l'outil vous renvoie. Il est possible d'utiliser un numéro d'accession GenBank comme modèle.

QuantPrime - est un programme flexible pour la conception d'amorces fiables à utiliser dans des expériences qPCR plus importantes. Le cadre flexible est également ouvert pour une utilisation simple dans d'autres applications de quantification, telles que la conception de sonde d'hydrolyse pour la qPCR et la conception de sonde oligonucléotidique pour la quantification in situ hybridation. (Référence : S. Arvidsson et al. 2008. BMC Bioinformatics 9:465)

PrimerQuest - (IDT, États-Unis)

Introduction de mutations :

WatCut (Michael Palmer, Université de Waterloo, Canada) - prend un oligonucléotide et introduit des mutations silencieuses dans des sites de restriction potentiels de telle sorte que la séquence d'acides aminés de la protéine ne soit pas altérée.

PrimerX - peut être utilisé pour automatiser la conception d'amorces mutagènes pour la mutagenèse dirigée. Il est disponible en deux saveurs (a) Conception d'amorce basée sur la séquence d'ADN et (b) Conception d'amorce basée sur la séquence de protéines

Primerize-2D - is designed to accelerate synthesis of large libraries of desired mutants through design and efficient organization of primers. The underlying program and graphical interface have been experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides and libraries encompassing up to 960 variants. ( Reference: Tian, S., & Das, R. (2017) Bioinformatics 33(9): 1405-1406).

When you are ready to set-up your PCR reaction see:

PCR Box Titration Calculator (Allotron Biosensor Corporation) - for figuring out the amounts of each reagent to use in a two-dimensional box titration for PCR. For standard PCR reactions adjust volume, and change "row" and "column" number to "1", click on all the "top" or "bottom" and "done". PCR Titration Calculator (Angel Herráez Cybertory: virtual molecular biology lab Universidad de Alcalá, Spain) is a similar site.

PCR Reaction Mixture Setup (R. Kalendar, University of Helsinki, Finland) - very nice site (requires Java).

PCR Optimization (Bioline, United Kingdom) - a lot of conditions

Primer presentation on the DNA sequence:

Sequence Extractor (Paul Stothard) - generates a clickable restriction map and PCR primer map of a DNA sequence (accepted formats are: raw, GenBank, EMBL, and FASTA) offering a great deal of control on output. Protein translations and intron/exon boundaries are also shown. Use Sequence Extractor to build DNA constructs in silico.


Loop-Mediated Isothermal Amplification

Loop-mediated isothermal amplification (LAMP) uses 4-6 primers recognizing 6-8 distinct regions of target DNA for a highly specific amplification reaction. A strand-displacing DNA polymerase initiates synthesis and 2 specially designed primers form &ldquoloop&rdquo structures to facilitate subsequent rounds of amplification through extension on the loops and additional annealing of primers. DNA products are very long (>20 kb) and formed from numerous repeats of the short (80&ndash250 bp) target sequence, connected with single-stranded loop regions in long concatamers. These products are not typically appropriate for downstream manipulation, but target amplification is so extensive that numerous modes of detection are possible. Real-time fluorescence detection using intercalators or probes, lateral flow and agarose gel detection are all directly compatible with LAMP reactions. Instrumentation for LAMP typically requires consistent heating to the desired reaction temperature and, where needed, real-time fluorescence for quantitative measurements. Optimized settings for running LAMP experiments on isothermal instruments can be found here.

Reaction Temperature Amplicon Size Detection Method(s)
65°C <250 nt Visual, Lateral flow, Gel, Turbidity

Loop-mediated isothermal amplification (LAMP) uses 4-6 primers recognizing 6-8 distinct regions of target DNA. A strand-displacing DNA polymerase initiates synthesis and 2 of the primers form loop structures to facilitate subsequent rounds of amplification.

In addition to the more traditional or complex detection methods, LAMP is so prolific that the products and byproducts of these reactions can also be visualized by eye. For example, magnesium pyrophosphate produced during the reaction can be observed as a white precipitate or added indicators like calcein or hydroxynaphthol blue can be used to signal a positive reaction. Alternatively, using the 2X Colorimetric LAMP Master Mix developed by NEB enables a strong color change from pink to yellow based on a pH change during the reaction. An updated version of this product has been formulated with dUTP and UDG to be compatible with carryover prevention between amplification rounds &ndash WarmStart Colorimetric LAMP 2X Master Mix with UDG. The colorimetric detection technology is a key component of the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit, which can be used in the analysis of SARS-CoV-2, the novel coronavirus that causes COVID-19.

Designing LAMP primers can be challenging, but software tools greatly facilitate this process. We suggest using the NEB LAMP Primer Design Tool to design LAMP primers. After inputting a DNA or RNA sequence of interest, the LAMP Primer Design tool will identify suitable target regions and create the outer F3/B3 and looping inner FIP/BIP primers in a single step. The LoopF/LoopB primers, that accelerate the LAMP reaction, are created in a second step and are strongly recommended for best performance.

LAMP is well-suited for point-of-care and field diagnostics and LAMP assays have been designed for the detection of a wide range of RNA and DNA targets from all manner of sample types. Examples include tests for:

The LAMP reaction is robust and tolerant of inhibitors, allowing for crude sample prep and minimal nucleic acid purification if desired. WarmStart ® RTx and Bst 2.0 WarmStart were developed for optimal performance in LAMP/RT-LAMP and are combined in convenient LAMP Master Mixes to simplify assay design.