Informations

Comment les insectes peuvent-ils survivre sans système immunitaire adaptatif ?


Comment les insectes peuvent-ils survivre dans un monde rempli d'agents pathogènes capables de vaincre le système immunitaire inné ?


Il n'y a pas vraiment d'explication définitive pour expliquer pourquoi, bien qu'il soit important de noter que de nombreux agents pathogènes des mammifères ne sont pas adaptés aux insectes et vice-versa. Les insectes ont besoin de survivre aux insectes pathogènes, et ils ont un certain nombre de défenses à cette fin. Les animaux et leurs agents pathogènes coévoluent et exercent des pressions de sélection les uns sur les autres.

Tuer l'hôte (ou tuer l'hôte rapidement) n'est souvent pas dans le meilleur intérêt du pathogène. Les agents pathogènes évoluent autant que les animaux vers leur propre reproduction réussie. Le succès peut finalement signifier évoluer vers un état moins pathogène qui améliore les chances de transmission d'un agent pathogène.

Au fur et à mesure que les animaux développent de nouvelles défenses, ils acquièrent un avantage (par rapport aux autres de leur propre espèce) pour survivre à divers agents pathogènes. Les agents pathogènes évoluent pour échapper à ces défenses, et un nouvel équilibre s'établit. Un animal dépourvu de ces défenses est susceptible d'être plus susceptible de mourir d'une infection, car le nouvel équilibre dépend de la possession de ces protections.

Voici un article intéressant sur ce point de vue : http://hedricklab.ucsd.edu/PDF/HEDRICKImmunity113.pdf


Comme mentionné par InactionPotential, les organismes et leurs parasites sont pris dans une course aux armements. Lorsqu'un organisme développe une nouvelle défense, les parasites dotés de traits qui leur permettent de survivre à ces défenses excellent et vice versa. Parasites doit équilibrer leur survie et leur reproduction avec celles de leurs hôtes ou disparaître. Au fil du temps, ils peuvent devenir commensaux/symbiotiques, se transférer à une autre espèce et/ou éradiquer son espèce hôte.

Le système immunitaire des invertébrés (y compris les insectes) dans son ensemble est assez compliqué. En raison de la diversité de ces systèmes, nous n'en aurons peut-être pas une compréhension complète avant des décennies. Certaines espèces régulent intentionnellement leur système immunitaire en prévision d'événements susceptibles de les exposer à des agents pathogènes. Les espèces d'insectes sociaux, comme les fourmis, ont développé des immunités spécialisées qui tirent parti du sacrifice individuel, de la reconnaissance de la situation et de la santé de la colonie. Les mouches des fruits possèdent des récepteurs d'immunoglobulines radicalement expressifs (IgSF), similaires à certains égards au complexe majeur d'histocompatibilité des vertébrés.

Cette diversité est la clé : le monde est plein d'agents pathogènes capables de vaincre certain systèmes immunitaires innés dans une certaine mesure. Cependant, la variété des défis présentés par même deux espèces différentes empêche généralement un agent pathogène de tuer tous de l'une ou l'autre espèce. Lorsqu'un agent pathogène s'adapte à une espèce, il peut perdre son aptitude pour l'autre. Si un agent pathogène est limité à une espèce, il doit se contenter de ce qu'il possède ou il disparaîtra avec son hôte.

Références et lectures complémentaires


Dans la réponse immunitaire innée, les agents pathogènes sont reconnus par un répertoire fixe de récepteurs de surface cellulaire et de molécules effectrices solubles. Ces récepteurs ont évolué pour reconnaître les agents pathogènes sur des centaines de millions d'années et fournir une formidable défense contre un large éventail d'agents pathogènes. L'immunité adaptative n'a évolué que chez les vertébrés et complète le système inné avec une stratégie très différente qui permet un nombre presque infini d'adaptations dans la production de cellules B et T. Que des formes de vie inférieures survivent sans cette adaptation n'est probablement qu'un témoignage de l'efficacité du système inné. Une grande partie de cette réponse doit être créditée au texte de Peter Parham,Le système immunitaire.


Les insectes ont généralement une durée de vie plus courte que de nombreux vertébrés, et comme ils sont plus petits, ils ont également une moindre quantité d'énergie investie dans la génération de membres individuels de l'espèce. Un grand nombre d'animaux ont un système nerveux et sont capables de se déplacer, et peuvent ainsi éviter activement les environnements qui pourraient leur être nocifs et avoir des prédateurs d'ordres de grandeur plus ou moins grands que l'organisme en question.

S'ils présentent des variations entre les individus pour la reconnaissance de soi et le complément, alors une plus grande capacité à reproduire rapidement plus d'individus différents avec une quantité moindre de nourriture peut aider à combler le déficit relatif de résistance aux maladies dû à l'absence d'immunité adaptative.

Pour les vertébrés, ce n'est généralement pas une option en raison des cycles de vie plus longs de chaque organisme par rapport aux insectes, aux bactéries ou aux virus.


Seuls les vertébrés disposent d'un système supplémentaire et plus sophistiqué de mécanismes de défense, appelé immunité adaptative, capable de reconnaître et de détruire des substances spécifiques. La réaction défensive du système immunitaire adaptatif est appelée réponse immunitaire. Toute substance capable de générer une telle réponse est appelée antigène ou immunogène. Les antigènes ne sont pas les micro-organismes et les tissus étrangers eux-mêmes, ce sont des substances --- telles que des toxines ou des enzymes --- dans les micro-organismes ou les tissus que le système immunitaire considère comme étrangers. Les réponses immunitaires sont normalement dirigées contre l'antigène qui les a provoquées et sont dites spécifiques à l'antigène. La spécificité est l'une des deux propriétés qui distinguent l'immunité adaptative de l'immunité innée. L'autre est appelée mémoire immunologique. La mémoire immunologique est la capacité du système immunitaire adaptatif à monter une réponse immunitaire plus forte et plus efficace contre un antigène après sa première rencontre avec cet antigène, laissant l'organisme mieux à même de lui résister à l'avenir.

L'immunité adaptative fonctionne avec l'immunité innée pour fournir aux vertébrés une résistance accrue aux micro-organismes, parasites et autres intrus qui pourraient leur nuire. Cependant, l'immunité adaptative est également responsable de réactions allergiques et du rejet de tissus transplantés, qu'elle peut confondre avec un envahisseur étranger nocif.


Allergies

Un allergie est un trouble dans lequel le système immunitaire fait une réponse inflammatoire à un antigène inoffensif. Il se produit lorsque le système immunitaire est hypersensible à un antigène dans l'environnement qui provoque peu ou pas de réponse chez la plupart des gens. Les allergies sont fortement familiales : les parents allergiques sont plus susceptibles d'avoir des enfants allergiques et ces enfants allergiques sont susceptibles d'être plus sévères. C'est la preuve qu'il existe une tendance héréditaire à développer des allergies. Les allergies sont plus fréquentes chez les enfants que chez les adultes, car de nombreux enfants dépassent leurs allergies à l'âge adulte.

Allergènes

Tout antigène qui provoque une allergie est appelé un allergène. Les allergènes courants sont les pollens de plantes, les acariens, les moisissures, des aliments spécifiques (comme les arachides ou les crustacés), les piqûres d'insectes et certains médicaments courants (comme l'aspirine et la pénicilline). Les allergènes peuvent être inhalés ou ingérés, ou ils peuvent entrer en contact avec la peau ou les yeux. Les symptômes varient selon le type d'exposition et la gravité de la réponse du système immunitaire. L'herbe à poux et le sumac vénéneux sont deux causes courantes d'allergies. L'inhalation de pollen d'ambroisie peut provoquer des symptômes de rhinite allergique, tels que des éternuements et des démangeaisons oculaires rouges. Le contact cutané avec les huiles contenues dans l'herbe à puce peut provoquer une éruption cutanée avec démangeaisons. Ce type d'allergie est appelé dermatite de contact.

Prévalence des allergies

Il y a eu une augmentation significative de la prévalence des allergies au cours des dernières décennies, en particulier dans les pays riches du monde, où les allergies sont maintenant des troubles très courants. Dans les pays développés, environ 20 pour cent des personnes ont ou ont eu le rhume des foins, 20 pour cent ont eu une dermatite de contact et environ 6 pour cent ont des allergies alimentaires. Dans les pays les plus pauvres du monde, en revanche, les allergies de tous types sont beaucoup moins courantes.

Une explication de l'augmentation des allergies dans le monde développé s'appelle l'hypothèse de l'hygiène. Selon cette hypothèse, les habitants des pays développés vivent dans des environnements relativement stériles en raison des pratiques d'hygiène et des systèmes d'assainissement. En conséquence, les habitants de ces pays sont exposés à moins d'agents pathogènes que leur système immunitaire n'a évolué pour y faire face. Pour compenser, leur système immunitaire « s'active » en attaquant des antigènes inoffensifs dans les réponses allergiques.

Comment se produisent les allergies

Figure (PageIndex<3>) : Ce diagramme montre comment le système immunitaire adaptatif est activé par un antigène par ailleurs inoffensif sur le pollen d'ambroisie, répondant à l'allergène comme s'il s'agissait d'un agent pathogène.

Le diagramme de la figure (PageIndex<3>) montre comment se produit une réaction allergique. Lors de la première exposition à un allergène, les cellules B sont activées pour former des plasmocytes qui produisent de grandes quantités d'anticorps contre l'allergène. Ces anticorps se fixent aux leucocytes appelés mastocytes. Par la suite, chaque fois que la personne rencontre à nouveau l'allergène, les mastocytes sont déjà amorcés et prêts à y faire face. Les mastocytes amorcés libèrent immédiatement des cytokines et des histamines, qui à leur tour provoquent une inflammation et le recrutement de leucocytes, entre autres réponses. Ces réponses sont responsables des signes et symptômes des allergies.

Traiter les allergies

Les symptômes des allergies peuvent aller de légers à potentiellement mortels. Les symptômes d'allergie légers sont souvent traités avec des antihistaminiques. Ce sont des médicaments qui réduisent ou éliminent les effets des histamines qui produisent des symptômes d'allergie.

Figure (PageIndex<4>) : l'anaphylaxie est une réaction systémique rapide aux allergènes qui peut entraîner des symptômes potentiellement mortels.

Traiter l'anaphylaxie

La réaction allergique la plus grave est une réaction systémique appelée anaphylaxie. Il s'agit d'une réponse potentiellement mortelle causée par une libération massive d'histamine. De nombreux signes et symptômes de l'anaphylaxie sont illustrés à la figure (PageIndex<4>). Certains d'entre eux incluent une baisse de la pression artérielle, des changements de fréquence cardiaque, un essoufflement et un gonflement de la langue et de la gorge, qui peuvent menacer le patient d'étouffement à moins qu'un traitement d'urgence ne soit administré. Les personnes qui ont eu des réactions anaphylactiques peuvent porter un auto-injecteur d'épinéphrine (largement connu sous son nom de marque EpiPen®) afin qu'elles puissent s'injecter de l'épinéphrine si elles commencent à ressentir une réaction anaphylactique. L'épinéphrine aide à contrôler la réaction immunitaire jusqu'à ce que des soins médicaux puissent être fournis. L'épinéphrine resserre les vaisseaux sanguins pour augmenter la pression artérielle, détend les muscles lisses des poumons pour réduire la respiration sifflante et améliorer la respiration, module la fréquence cardiaque et agit pour réduire l'enflure qui pourrait autrement bloquer les voies respiratoires.

Immunothérapie pour les allergies

Une autre façon de traiter les allergies s'appelle immunothérapie, communément appelé &ldquoallergy shots.&rdquo Cette approche peut en fait guérir des allergies spécifiques, au moins pendant plusieurs années, voire toute la vie. Il peut être particulièrement bénéfique pour les allergènes tels que le pollen qui sont difficiles ou impossibles à éviter. D'abord, cependant, les patients doivent être testés pour identifier les allergènes spécifiques qui causent leurs allergies. Comme le montre la figure (PageIndex<5>), cela peut impliquer de gratter de minuscules quantités d'allergènes communs dans la peau, puis d'observer s'il y a une réaction localisée à l'un d'entre eux. Chaque allergène est appliqué à un endroit numéroté différent sur la peau. Ainsi, s'il y a une réaction, telle qu'une rougeur ou un gonflement, les allergènes responsables peuvent être identifiés. Ensuite, grâce à des injections périodiques (généralement hebdomadaires ou mensuelles), les patients sont progressivement exposés à des quantités de plus en plus importantes d'allergènes. Au fil du temps, généralement de quelques mois à plusieurs années, le système immunitaire devient désensibilisé aux allergènes. Cette méthode de traitement des allergies est souvent efficace pour les allergies au pollen ou aux piqûres d'insectes, mais son utilité pour les allergies alimentaires n'est pas claire.

Figure (PageIndex<5>) : les tests cutanés pour les allergènes courants sont un moyen d'identifier la ou les causes des symptômes allergiques d'un patient.


Comment un agent pathogène échappe au système immunitaire

T. brucei provoque la maladie du sommeil. Crédit : Meyer-Natus/Siegel

Une équipe de recherche LMU dirigée par Nicolai Siegel a découvert un mécanisme qui permet au parasite responsable de la maladie du sommeil chez l'homme d'échapper à l'attention du système immunitaire. La découverte peut également être pertinente pour d'autres maladies infectieuses.

Notre système immunitaire n'est jamais inactif. Leur tâche est de détecter et d'éliminer les agents pathogènes invasifs, et ils n'ont pas de temps à perdre. Le système immunitaire adaptatif identifie les organismes infectieux en reconnaissant les protéines étrangères à la surface des bactéries, des virus et des protozoaires unicellulaires. L'interaction de ces antigènes avec les cellules immunitaires déclenche une série d'événements en aval qui, dans la plupart des cas, conduisent à l'élimination de l'agent pathogène.

Mais les organismes pathogènes ont développé des stratégies qui leur permettent d'échapper à la détection par le système immunitaire, et les stratégies employées par les organismes éloignés sont souvent remarquablement similaires les unes aux autres. Une façon de confondre le système immunitaire est d'augmenter l'hétérogénéité structurelle des antigènes qu'il rencontre. Chez les bactéries, les levures pathogènes et les parasites, cela peut être fait en activant au hasard différents membres de familles de gènes, qui codent pour des versions non identiques des protéines exprimées à leur surface. Cette stratégie permet essentiellement à l'agent infectieux de passer sous le radar du système immunitaire. Ce faisant, il augmente considérablement la probabilité que l'envahisseur survive pour établir une infection et a une meilleure chance d'être transmis à de nouveaux hôtes. Si les agents pathogènes modifient rarement ou trop souvent leurs protéines de surface, les globules blancs qui sont chargés de les reconnaître ont une tâche beaucoup plus facile. Nicolai Siegel (professeur de parasitologie moléculaire au LMU) et son groupe, en collaboration avec des collègues de l'Université de Dundee, ont maintenant élucidé une étape importante dans le mécanisme qui contrôle la variation de l'antigène de surface.

Le modèle expérimental : Trypanosomes

Bien que l'équipe de Siegel fasse partie du département de parasitologie expérimentale et affiliée à la faculté de médecine vétérinaire du LMU, elle utilise des laboratoires situés dans la section de chimie physiologique du centre biomédical (faculté de médecine). "Cet arrangement facilite grandement la discussion scientifique et les échanges interdisciplinaires", dit-il.

Son équipe travaille avec l'organisme unicellulaire Trypanosoma brucei. Il y a plusieurs raisons à cela. T. brucei provoque la maladie du sommeil. Elle est transmise par la mouche tsé-tsé et représente une menace pour des millions de personnes dans 36 pays africains au sud du Sahara. D'un point de vue scientifique, cependant, cette espèce est devenue un système modèle pour l'étude de la variation des antigènes chez les agents pathogènes, et a donc été largement étudiée.

Le génome de T. brucei comprend plus de 2000 gènes qui codent pour des variantes de la protéine principale exprimée à sa surface. Dans chaque cellule individuelle, un seul de ces gènes est activé et il dirige la production d'une seule variante de protéine de surface. "L'agent pathogène doit donc s'assurer qu'un seul de ces gènes - pas quelques-uns, et certainement pas tous - des gènes des protéines de surface sont exprimés à un moment donné", explique Siegel. "Nous avons maintenant identifié le mécanisme qui garantit que le produit d'un seul de ces gènes est exprimé."

Notamment, T. brucei ne possède pas de matrices complexes de séquences génomiques régulatrices, telles que des amplificateurs, qui sont impliquées dans la détermination de l'ensemble de gènes qui sont transcrits à partir de l'ADN génomique en ARN messagers (ARNm) à un moment donné. Ces ARNm dirigent ensuite la synthèse des protéines correspondantes. "Le mécanisme de contrôle que nous avons découvert semble atteindre la sélectivité requise en régulant différemment la maturation de l'ARNm", explique Siegel. Ceci à son tour est accompli en modifiant chimiquement des ARNm spécifiques, ce qui les empêche d'être rapidement détruits.

Les auteurs de la nouvelle étude ont identifié une structure tridimensionnelle dans le noyau de T. brucei qui sert de compartiment séparé, dans lequel les molécules d'ARNm qui codent pour la variante de protéine de surface unique de la cellule sont modifiées. En conséquence, ils évitent une destruction rapide et survivent donc assez longtemps pour produire la protéine dans la quantité requise. A l'inverse, lorsqu'une des protéines contribuant à l'assemblage de ce compartiment était inactivée, plusieurs antigènes de surface différents étaient synthétisés en même temps.

"Nous savons donc maintenant pourquoi un seul antigène de surface est exprimé avec succès", explique Siegel. De plus, ces nouveaux résultats ont des implications qui transcendent leur importance pour la recherche fondamentale. "Si nous pouvions contrôler le processus qui conduit à la commutation des antigènes de surface, il serait peut-être possible de l'inhiber", pense-t-il. Et en effet, à moyen terme, il voit dans cette possibilité une nouvelle approche de l'élimination - par le système immunitaire de l'organisme - des agents pathogènes qui dépendent de cette forme de variation antigénique.


Il s'agit d'un article en libre accès distribué selon les termes de la Creative Commons Attribution License, qui permet une utilisation, une distribution et une reproduction sans restriction sur n'importe quel support, à condition que l'œuvre originale soit correctement citée.

Les références

Boomsma J. J., Schmid-Hempel P. & amp Hughes W. O. H.

. 2005 Cycles de vie et pression parasitaire des principaux groupes d'insectes sociaux . Écologie évolutive des insectes (éds

, Fellowes M.D.E., Holloway G.J.& Rolff J.

), p. 139-175. Wallingford, Royaume-Uni : Éditions CABI . Google Scholar

. 1998 Principes de la pathologie des insectes. Norwell, MA : Kluwer. Référence croisée, Google Scholar

. Revue 2009. Analogies dans l'évolution de l'immunité individuelle et sociale. Phil. Trans. R. Soc. B 364, 129-142. (doi: 10.1098/rstb.2008.0166). Lien, Google Scholar

Cremer S., Armitage S.A.O.& Schmid-Hempel P.

Hughes W. O. H., Eilenberg J. et Boomsma J. J.

. 2002 Compromis dans la vie en groupe : transmission et résistance aux maladies chez les fourmis coupe-feuilles . Proc. R. Soc. Londres. B 269, 1811–1819. (doi:10.1098/rspb.2002.113). Lien, ISI, Google Scholar

Hughes W. O. H., Petersen K., Ugelvig L., Pedersen D., Thomsen L., Poulsen M. & Boomsma J. J.

. 2004 une Densité-dépendance et compétition intra-hôte chez un parasite sémelpare des fourmis coupe-feuilles. BMC Évol. Biol. 4, 45. (doi:10.1186/1471-2148-4-45). Crossref, PubMed, Google Scholar

Hughes W. O. H., Thomsen L., Eilenberg J. et Boomsma J. J.

. 2004 b Diversité des champignons entomopathogènes à proximité des nids de fourmis coupeuses de feuilles dans une forêt néotropicale, avec une référence particulière à Metarhizium anisopliae var. anisoplies. J. Invertébr. Pathol. 85, 46-53. (doi:10.1016/j.jip.2003.12.005). Crossref, PubMed, Google Scholar

. 2007 L'apprentissage social chez les insectes—des cerveaux miniatures à la recherche de consensus . Cour. Biol. 17, R703–R713. (doi:10.1016/j.cub.2007.06.012). Crossref, PubMed, ISI, Google Scholar

Rosengaus R. B., Maxmen A. B., Coates L. E. & amp Traniello J. F. A.

. 1998 Résistance aux maladies : un avantage de sociabilité chez la termite du bois humide Zootermopsis angusticollis (Isoptera : Termopsidae) . Comportez-vous. Écol. Sociobiol. 44, 125-134. (doi:10.1007/s002650050523). Crossref, ISI, Google Scholar

. 1998 Parasites chez les insectes sociaux. Princeton, New Jersey : Princeton University Press. Google Scholar

. 2003 Importance statistique pour les études pangénomiques . Proc. Natl Acad. Sci. Etats-Unis 100, 9440–9445. (doi:10.1073/pnas.1530509100). Crossref, PubMed, ISI, Google Scholar

Traniello J. F. A., Rosengaus R. B. & Savoie K.

. 2002 Le développement de l'immunité chez un insecte social : preuve de la facilitation de groupe de la résistance aux maladies . Proc. Natl Acad. Sci. Etats-Unis 99, 6838-6842. (doi:10.1073/pnas.102176599). Crossref, PubMed, ISI, Google Scholar


Discussion

Les moustiques sont sensibles aux infections à toutes les étapes de leur cycle de vie et, en réponse, ils ont développé un système immunitaire inné robuste [1]. Les moustiques acquièrent des agents pathogènes par ingestion et par des brèches dans la cuticule externe, comme lors d'une blessure. Par exemple, les larves acquièrent Bacillus thuringiensis en se nourrissant dans leur milieu aquatique, et les adultes acquièrent Plasmodium sp. tout en s'imbibant de sang de vertébré infecté [10, 98]. Étant donné que le stade adulte est responsable de la transmission d'agents pathogènes pathogènes tels que le paludisme [9, 10], la grande majorité des recherches sur l'immunologie des moustiques se sont concentrées sur ce stade de la vie, et en particulier sur les femelles adultes qui se nourrissent de sang. . En revanche, les recherches sur le système immunitaire des larves d'autres insectes, tels que Manduca sexta, Bombyx mori et Drosophila melanogaster s'est avérée inestimable pour découvrir les aspects fondamentaux de la réponse immunitaire cellulaire et humorale des insectes et des animaux en général [99, 100, 101]. Néanmoins, il manque à Insecta des études comparatives qui examinent les différences d'immunité à travers les différents stades de la vie d'une espèce donnée. Comme l'ont noté Fellous & Lazzaro, « presque toutes les études sur le système immunitaire des animaux métamorphosés se sont concentrées sur l'immunité larvaire ou adulte, supposant implicitement que ces traits sont soit parfaitement corrélés, soit indépendants de l'évolution » [41]. Étant donné que les larves de moustiques vivent dans des environnements aquatiques riches en micro-organismes et que la survie à travers les stades larvaires est nécessaire pour atteindre la maturité sexuelle, au début de cette étude, nous avons émis l'hypothèse que les larves ont développé des moyens plus efficaces de neutraliser les infections que les adultes. Comparer l'immunité larvaire et adulte chez A. gambiae, nous avons mesuré un large éventail de paramètres immunitaires qui n'avaient pas été examinés auparavant chez les larves, et montrons que l'activité immunitaire est la plus forte chez les larves et diminue au stade de la vie adulte (tableau 1). De plus, comme les phénotypes immunitaires diffèrent entre les stades de la vie séparés par la métamorphose, ces résultats suggèrent que le découplage adaptatif, ou l'évolution indépendante des traits larvaires et adultes rendus possibles par la métamorphose [40], s'est produit dans A. gambiae.

Des preuves du découplage adaptatif ont été trouvées chez un large éventail d'animaux aux cycles de vie complexes, notamment les amphibiens, les poissons, les invertébrés marins et les insectes [40, 41, 102,103,104,105,106,107,108]. Plusieurs sources de données suggèrent qu'un découplage adaptatif des réponses immunitaires s'est également produit dans la lignée des moustiques. Premièrement, nous avons montré que la force et la composition de la réponse immunitaire des moustiques diffèrent entre les larves immatures, les adultes nouvellement émergés et les adultes plus âgés actifs sur le plan de la reproduction. Deuxièmement, nous avons déjà montré [11, 48, 55], et récapitulons ici, que les systèmes circulatoire et immunitaire des moustiques présentent une intégration fonctionnelle spécifique à un stade, permettant des stratégies immunitaires fonctionnellement analogues, mais anatomiquement disparates, chez les larves et les adultes. Troisièmement, les moustiques ont des cycles de vie complexes avec des stades larvaires et adultes écologiquement distincts qui sont soumis à des pressions de sélection différentes, en raison des différences d'exposition aux agents pathogènes et de statut reproducteur. Ainsi, nous nous attendons à ce qu'un découplage des traits clés entre ces stades de la vie, qui sont séparés par métamorphose, soit avantageux pour les deux stades en répondant indépendamment à différentes pressions de sélection et dans l'exécution de différentes tâches de fitness (par exemple, la consommation alimentaire et la croissance en larves et reproduction chez les adultes). Pris ensemble, ces arguments suggèrent qu'un découplage adaptatif s'est produit chez les moustiques, permettant l'évolution indépendante des principaux traits immunitaires des larves et des adultes.

Nos données montrent que les larves tuent les bactéries à un taux plus élevé, possèdent plus d'hémocytes circulants, ont une activité lytique et mélanique plus élevée dans leur hémolymphe et ont une expression des gènes immunitaires induite par l'infection plus élevée que les adultes, soutenant ainsi fortement notre hypothèse selon laquelle les larves de moustiques investissent davantage dans immunitaire que les adultes. À notre avis, ce n'est pas surprenant que les larves habitent des environnements riches en bactéries et présentent une diversité microbienne intestinale plus élevée que les adultes [44, 109], ce qui suggère que les moustiques sont exposés à une densité et une diversité de bactéries plus élevées en tant que larves qu'en tant qu'adultes, et nécessitent plus de robustesse. réponses immunitaires sous forme de larves, comme cela a été supposé précédemment [110]. Ainsi, étant donné les écologies très différentes entre les larves et les adultes, couplées au fait que les pressions évolutives sont les plus fortes sur les individus plus jeunes qui n'ont pas encore atteint leur potentiel reproducteur [34, 35], nous émettons l'hypothèse que les pressions de sélection plus fortes à l'œuvre chez les larves stade, par rapport au stade adulte, ont au fil du temps amené les larves à investir davantage dans l'immunité que les adultes.

Nos résultats sur la compétence immunitaire des larves et des adultes indiquent également une sénescence immunitaire, car l'immunité des larves est plus forte que celle des adultes et l'immunité continue de s'affaiblir après la métamorphose, les adultes de 5 jours développant des réponses immunitaires plus faibles que les adultes de 4 ans. jours plus jeune. Cette découverte est cohérente avec les théories évolutives bien attestées de la sénescence, qui affirment que des pressions de sélection plus importantes sont à l'œuvre au stade larvaire pour assurer la survie jusqu'au stade de la vie adulte mature [34, 36]. Selon la théorie du vieillissement « Soma jetable », cela se produit, en partie, en raison de compromis immunitaires qui ne seraient pas en jeu au stade larvaire, en particulier ceux liés à la reproduction [111]. Par exemple, la résistance aux agents pathogènes chez les moustiques adultes a été associée à des coûts de reproduction [112,113,114,115]. En outre, de nombreuses études ont documenté des déclins associés à l'âge des fonctions immunitaires chez les moustiques [13, 26, 46, 47, 110, 116,117,118,119,120], les mouches des fruits [121,122,123], les papillons [124, 125], les abeilles [126,127,128,129,130] et d'autres insectes [131 132 133 134 135]. Cependant, contrairement à ces études antérieures, qui se concentraient presque exclusivement sur les adultes, nos résultats montrent que cette tendance s'étend jusqu'au stade de la vie larvaire plus précoce. Cela suggère que les moustiques adultes utilisent une stratégie de cycle de vie « vivre vite, mourir jeune » [136], selon laquelle l'immunité diminue et la mortalité augmente une fois que les adultes ont atteint la maturité reproductive et que la sélection pour leur survie diminue [34].

Bien que les données présentées dans cette étude montrent de manière concluante que les larves développent une réponse immunitaire plus forte que les adultes contre les bactéries présentes dans l'hémocèle, le stade adulte a développé des mécanismes pour renforcer le système immunitaire lorsque la possibilité d'une infection est anticipée. Principalement, parce que de nombreuses infections chez l'adulte commencent par un repas de sang infectieux [6, 10, 137], les moustiques adultes renforcent leurs réserves immunitaires lors de l'ingestion de sang. Par exemple, dans les deux sous-familles de moustiques, l'acquisition d'un repas de sang induit la réplication des hémocytes même en l'absence d'infection [138,139,140]. On ne sait pas si cela a un impact positif sur la capacité des moustiques anophèles à répondre à une infection dans l'hémocèle, mais pour A. aegypti (un moustique culicine), l'alimentation sanguine améliore la capacité de lutter contre une faible dose E. coli infection mais est préjudiciable face à une dose élevée E. coli infection [140].

La diminution de la compétence immunitaire en fonction de l'âge est en corrélation avec les changements liés à l'âge du nombre d'hémocytes circulants présents dans l'hémocèle. Nous avons constaté que les larves de moustiques contiennent plus d'hémocytes circulants que les moustiques adultes et que le nombre d'hémocytes larvaires augmente en réponse à l'infection. Ceci est cohérent avec des études antérieures menées en Anopheles gambiae et Aedes aegypti adultes qui ont montré que la stimulation immunitaire ou l'alimentation sanguine augmente le nombre d'hémocytes circulants [26, 45, 86, 138,139,140,141,142], et que le nombre d'hémocytes circulants diminue avec l'âge adulte [26, 46, 47, 116]. Les hémocytes sont les premiers répondeurs cellulaires à l'infection, phagocytent les agents pathogènes chez les larves et les adultes dans les minutes suivant l'infection [11, 48, 55, 57, 143, 144] et produisent des facteurs qui limitent à la fois les bactéries et Plasmodium infection [66, 86, 137, 145]. Ainsi, les changements de développement dans les profils des hémocytes expliquent en partie l'efficacité de destruction des bactéries plus élevée des larves par rapport aux adultes.

Bien que les hémocytes sessiles aient été abondants chez les larves et les adultes, la disposition spatiale des hémocytes sessiles différait à mesure que les adultes vieillissaient, les adultes nouvellement émergés présentant une disposition segmentaire prononcée des hémocytes, qui ressemble plus à ce qui est observé chez les larves qu'à ce qui est observé dans Adultes de 5 jours [11, 46]. De plus, alors que les hémocytes des adultes s'agrègent dans les régions périostées du cœur, les hémocytes des larves s'agrègent dans les touffes trachéales du 8e segment abdominal, là où se trouve la seule ouverture incourante dans le cœur. Ces différences sont dues à l'intégration fonctionnelle spécifique au stade des systèmes immunitaire et circulatoire, car les hémocytes s'agrègent dans les zones où le flux d'hémolymphe est le plus élevé [11, 46, 48, 55]. Ces différences peuvent également s'expliquer par des modifications de la physiologie cardiaque spécifiques au stade et à l'âge [42, 146]. Dans l'ensemble, ces données montrent que les populations d'hémocytes sessiles subissent des changements liés au développement de la configuration spatiale et de l'abondance induite par l'infection.

La découverte que les larves ont plus d'hémocytes circulants que les adultes peut expliquer la découverte apparemment contre-intuitive que les larves présentent des indices et des capacités phagocytaires inférieurs à ceux des adultes. En effet, les larves ont plus d'hémocytes disponibles pour phagocyter les agents pathogènes que les adultes, et sur la base de nos découvertes sur l'activité lytique et mélanique de l'hémolymphe, elles ont également un plus grand recours à d'autres moyens d'élimination des agents pathogènes. Ainsi, une accumulation d'événements phagocytaires chez les adultes peut signifier un plus grand besoin de ce mécanisme immunitaire, ou des taux de renouvellement phagocytaire plus faibles, ce qui a également été observé chez les adultes de mouches des fruits vieillissants [121]. Fait intéressant, ces différences de phagocytose s'accompagnent de changements dans la morphologie des hémocytes. Les hémocytes larvaires avaient souvent une morphologie de propagation de type fibroblaste, qui a été observée dans d'autres hémocytes d'insectes [27, 147], par opposition à la morphologie de propagation plus arrondie typique des hémocytes adultes de moustiques [26, 46, 48, 56, 57, 143 ]. Ces hémocytes en forme de fibroblaste ont les caractéristiques fonctionnelles des granulocytes, qui sont phagocytaires, et non les caractéristiques fonctionnelles des œnocytoïdes, qui sont les principaux producteurs des enzymes phénoloxydases qui pilotent la voie de mélanisation [3, 56, 57].

En plus des différences spécifiques au stade dans la biologie des hémocytes, nous avons détecté de profondes différences dans l'activité de mélanisation de l'hémolymphe. La mélanisation est couramment utilisée dans la réponse immunitaire contre les bactéries, le paludisme et les filaires [2, 7, 59, 148], et nous avons constaté que les larves de moustiques présentent une bien plus grande capacité de mélanisation humorale médiée par la phénoloxydase que les adultes. Ce résultat est cohérent avec nos récentes observations de dépôts rapides et étendus de mélanine dans l'abdomen des larves suite à une infection bactérienne [11], ainsi qu'avec le déclin de l'activité de la phénoloxydase qui se produit avec l'âge adulte chez Aedes aegypti [117], et à travers le stade de la vie et avec l'âge adulte dans Culex pipiens [110]. En plus de renforcer l'immunité humorale, les larves peuvent augmenter l'activité de mélanisation de l'hémolymphe en vue du bronzage des cuticules pendant et immédiatement après la mue, et pour la mélanisation rapide des plaies dans l'environnement aquatique plus périlleux des larves.

Dans notre dernière série d'expériences, nous montrons que l'induction des gènes d'immunité est généralement plus forte chez les larves que chez les adultes, la différence étant exacerbée à mesure que les adultes vieillissent, et que les larves et les adultes régulent différemment l'expression de certains gènes d'immunité. Le taux plus élevé de E. coli la mort chez les larves est compatible avec l'expression de gènes effecteurs immunitaires tels que le gène de la protéine de liaison Gram (-), GNBPB4, qui était exprimé 470 et 710 fois plus élevé chez les larves naïves que chez les adultes naïfs âgés de 1 jour et 5 jours, respectivement, ainsi que l'expression plus élevée du gène de la phénoloxydase PPO1, qui était exprimé 170 et 110 fois plus chez les larves que chez les adultes naïfs de 1 jour et de 5 jours, respectivement. Le taux de mélanisation plus élevé que nous avons observé dans l'hémolymphe larvaire est également cohérent avec le taux plus élevé de PPO6 l'induction de gènes que nous avons observée chez les larves, et appuie notre conclusion précédente d'une mélanisation plus élevée induite par l'infection dans l'abdomen des larves par rapport aux adultes [11]. De plus, l'activité de mélanisation plus élevée dans l'hémolymphe des larves est également compatible avec le niveau élevé de double oxydase (DUOX) l'induction de gènes détectée à ce stade de la vie, car l'augmentation des niveaux d'espèces réactives de l'oxygène a été corrélée à une augmentation de la mélanisation [93]. En plus des gènes effecteurs immunitaires PPO6 et DUOX, nous avons également constaté que le membre de la voie essentielle Jak/Stat AGSTAT-A et, dans une moindre mesure, le régulateur négatif de cette voie, PIAS, ont été induits en réponse à E. coli l'infection chez les larves et non chez les adultes, ce qui montre que la même infection entraîne une induction spécifique au stade des gènes de la voie de signalisation. La régulation à la hausse du membre de la voie Imd CASPL1 chez les larves et les adultes d'un jour est cohérent avec le rôle de cette voie dans la lutte contre les infections bactériennes à Gram (-), cependant la cause de l'implication de la voie Jak/Stat dans la réponse larvaire seule est inconnue, bien qu'elle puisse être liée à sa fonction dans le développement des moustiques [82], car cette voie est impliquée dans Drosophile développement [149]. Les adultes, et non les larves, ont montré une régulation positive distincte de l'oxyde nitrique synthase, une composante importante de la réponse immunitaire de l'adulte [91, 150], ainsi qu'une régulation positive plus élevée du gène de reconnaissance du pathogène. FREP13 et le gène de modulation du signal CLIPB15. Ces différences dans l'induction des gènes d'immunité à travers les étapes de la vie pourraient résulter de changements dans les tissus exprimant ces gènes au cours de la métamorphose, comme cela a été supposé précédemment [28, 41]. Plus généralement, cependant, ces différences dans la régulation des gènes immunitaires chez les larves et les adultes suggèrent un découplage adaptatif, qui permettrait une régulation indépendante de l'expression des gènes immunitaires larvaires et adultes [40, 41].

Bien que les données présentées ici montrent la formidable force du système immunitaire larvaire par rapport à celui des adultes, ces données ont été recueillies suite à l'injection intrahémocoélique d'un agent pathogène facultatif, et non après l'alimentation d'un agent pathogène obligatoire. La voie d'administration et le choix de l'agent pathogène étaient nécessaires pour garantir qu'une dose identique avec un agent pathogène connu était fournie à tous les groupes et pour établir un moment précis d'infection. Alors que de nombreux agents pathogènes, y compris les bactéries et les champignons entomopathogènes, envahissent l'hémocèle directement à travers la cuticule, de futures études axées sur les infections via l'intestin devraient être menées pour compléter et affiner notre compréhension des travaux actuels. De plus, bien que cette étude n'ait pas suivi la survie à long terme des moustiques (les larves commencent à se nymphoser après 24 h), la conséquence à long terme de l'infection larvaire au stade adulte est une lacune importante dans notre compréhension actuelle et est un sujet permanent de étudier dans notre groupe de recherche. Enfin, nos expériences sur la biologie des hémocytes n'ont pas différencié les granulocytes, les œnocytoïdes ou les prohémocytes en raison des limitations inhérentes à la méthode de coloration cellulaire, mais il est bien établi qu'environ 95% des hémocytes sont des granulocytes [3], et nos observations qualitatives suggèrent que Le stade de la vie n'a pas d'impact sur la proportion de types d'hémocyte.


Résultats

Réponses immunitaires défectueuses contre l'infection par le virus de la grippe chez les souris fortement exposées à la chaleur.

Pour évaluer les effets de la température ambiante sur l'induction de l'immunité adaptative à l'infection par le virus de la grippe, les souris ont été maintenues à 4, 22 ou 36 °C pendant 7 jours avant l'infection par le virus de la grippe. L'exposition au froid ou à la chaleur élevée des souris naïves était généralement bien tolérée (Annexe SI, Fig. S1UNE). Bien que les souris naïves exposées au froid aient montré une augmentation significative de leur apport alimentaire par rapport au groupe exposé à la température ambiante (RT) (Annexe SI, Fig. S1B), l'exposition à des températures élevées de souris naïves a significativement réduit leur apport alimentaire et leur poids corporel de 10 % (Annexe SI, Fig. S1 B et C). Des souris exposées au froid ou à une chaleur élevée ont ensuite été infectées i.n. avec une dose sublétale (30 pfu) de virus grippal A/PR8. Après infection par le virus de la grippe, les souris exposées au froid ou à la chaleur élevée ont été maintenues à 4 ou 36 °C, respectivement, pendant toute la durée des expériences. Remarquablement, à la fois la fréquence (Fig. 1UNE et Annexe SI, Fig. S2) et le nombre (Fig. 1B) des cellules CD8 + T spécifiques du virus de la grippe dans le poumon ainsi que l'anticorps IgG spécifique du virus (Fig. 1C) et les réponses des lymphocytes T CD4 + (Fig. 1) étaient sévèrement altérées chez les souris fortement exposées à la chaleur. En conséquence, le titre viral dans les poumons est resté significativement élevé chez les souris fortement exposées à la chaleur 7 jours après l'infection (p.i.) (Annexe SI, illustration S3UNE). En outre, des CD de mLN fraîchement isolées de souris fortement exposées à la chaleur infectées par le virus de la grippe A recombinant exprimant le peptide MHC-I OVA SIINFEKL dans la tige de neuraminidase (NA) du squelette A/PR8 (virus PR8-OT-I), dans le absence de peptide exogène, n'a induit aucune différenciation des cellules Tg Tg OT-I CD8 TCR spécifiques de l'épitope OVA présenté sur H-2D b ex vivo (Fig. 1E).Ce défaut était probablement dû à une altération de la migration des CD pulmonaires capturées par l'antigène vers le mLN chez les souris fortement exposées à la chaleur, car les mêmes CD mLN étaient capables de différencier les cellules T CD8 naïves OT-I après l'ajout de peptide OVA exogène (Fig. 1F). De plus, la migration des CD pulmonaires capturées par l'antigène vers le mLN était gravement altérée chez les souris fortement exposées à la chaleur (Fig. 1 g et H), dans laquelle les CD de MHC-II + CD11c + poumon étaient comparables à celles observées chez les souris exposées à la RT (Annexe SI, fig. S4). Ces données suggèrent que la migration des CD pulmonaires capturées par l'antigène vers le mLN est altérée chez les souris fortement exposées à la chaleur. Par conséquent, la prolifération des cellules T CD8 + OT-I naïves transférées de manière adoptive a été réduite dans les mLN de souris fortement exposées à la chaleur 5 jours après l'infection par le virus PR8-OT-I (Fig. 1 je et J).

Les souris fortement exposées à la chaleur ne parviennent pas à induire une immunité adaptative à l'infection par le virus de la grippe. Les souris ont été maintenues à 4, 22 ou 36 °C pendant 7 jours avant l'infection par le virus de la grippe (30 pfu par souris) et tout au long de l'infection. (UNE) Dix jours plus tard, les lymphocytes ont été isolés du poumon. Des cellules CD8 + T spécifiques du virus de la grippe ont ensuite été détectées à l'aide du tétramère de nucléoprotéine (NP) du virus de la grippe H-2D b. (B) Le nombre total de cellules CD8 + T spécifiques du virus de la grippe dans les poumons est indiqué. (C) Le sérum a été collecté 10 jours après l'infection. Les taux d'IgG sériques spécifiques du virus de la grippe ont été mesurés par ELISA. () Les cellules CD4 + T ont été isolées de la rate et restimulées avec des splénocytes irradiés en présence ou en l'absence de virus grippal inactivé pendant 72 h, et la production d'IFN-γ à partir des cellules CD4 + T a été mesurée par ELISA. (E et F) Des cellules naïves OT-I CD8 + T (2 × 10 5 cellules par puits) ont été co-cultivées avec CD11c + DC (1 × 10 5 cellules par puits) qui ont été isolées des mLN d'animaux infectés par le virus PR8-OT-I avec (F) ou sans (E) Peptide NP ou OVA. Des DC spléniques (1 × 10 5 cellules par puits) d'animaux infectés ont été utilisées comme contrôle négatif. Soixante-douze heures plus tard, la production d'IFN-γ a été mesurée par ELISA. (g et H) Les souris ont été inoculées par voie intranasale avec de la DQ-ovalbumine (DQ-OVA). Six heures plus tard, les souris ont été infectées avec 1 000 pfu de virus PR8. Dix-huit heures après l'infection, les mLN ont été collectés. Les nombres adjacents aux zones délimitées indiquent le pourcentage de DQ-OVA + CD11c + DC (g). Les pourcentages de DQ-OVA + CD11c + DC sont indiqués (H). (je) Des souris ont reçu une injection de cellules OT-I CD8 + CD45.1 + T marquées au CFSE la veille de l'infection avec 1 000 pfu de virus PR8-OT-I. Cinq jours après l'infection par le virus de la grippe, les mLN ont été excisés pour évaluer la prolifération des lymphocytes T par dilution CFSE. (J) Le nombre total de cellules CD45.1 + dans les mLN est indiqué. (K) Le BALF a été prélevé sur des animaux infectés par le virus de la grippe 2 jours après l'infection. Les niveaux d'IL-1β dans BALF ont été déterminés par ELISA. Les données sont représentatives de trois expériences indépendantes (UNE, g, et je) ou proviennent de trois expériences indépendantes (B, F, H, JK moyenne ± SEM). *P < 0.05, **P < 0.01, et ***P < 0,001 n.s., non significatif (ANOVA à un facteur et test de Tukey).

Nous avons ensuite examiné si le virus de la grippe se réplique dans les poumons de souris fortement exposées à la chaleur. Nous avons constaté que les souris fortement exposées à la chaleur supportaient une charge virale élevée dans les poumons jusqu'à 7 jours p.i. (Annexe SI, illustration S3UNE). De plus, l'étendue de l'infection par le virus de la grippe dans les poumons des souris fortement exposées à la chaleur était similaire à celle des souris exposées à la RT (Annexe SI, illustration S3B), suggérant que l'incapacité des souris exposées à la chaleur à monter les réponses immunitaires adaptatives spécifiques au virus n'était pas due à la réplication virale dans le tissu pulmonaire. La migration des CD pulmonaires capturées par l'antigène vers le mLN et l'induction de réponses cellulaires CD8 + T spécifiques au virus de la grippe nécessitent l'activation de l'inflammasome et la signalisation IL-1R dans les CD pulmonaires (15, 16). Cela nous a conduit à envisager la possibilité que les souris fortement exposées à la chaleur ne parviennent pas à stimuler la sécrétion de cytokines dépendantes de l'inflammasome après une infection par le virus de la grippe. Pour tester cette possibilité, nous avons mesuré les niveaux d'IL-1β sécrétée dans le liquide de lavage bronchoalvéolaire (BALF) de souris exposées au froid, à la RT ou à une chaleur élevée infectées par le virus de la grippe. Notamment, les souris fortement exposées à la chaleur ont altéré la sécrétion d'IL-1β mature dans le BALF (Fig. 1K) ainsi que l'expression de l'ARNm de la pro-IL-1β dans les tissus pulmonaires et la sécrétion d'IFN-α, d'IL-6, d'IL-12p40 et de TNF-α (Annexe SI, Fig. S5) suite à une infection par le virus de la grippe. Ces données ont indiqué que les réponses immunitaires chez les souris fortement exposées à la chaleur sont altérées et que les voies critiques connues pour initier des réponses immunitaires adaptatives, notamment l'activation de l'inflammasome et la migration des DC pulmonaires, sont gravement compromises chez les souris maintenues à une température ambiante élevée.

Effets de l'exposition à haute température des souris dans l'induction de l'immunité adaptative aux agents pathogènes à transmission vectorielle.

Pour examiner si l'exposition à une chaleur élevée des souris a entraîné une immunodéficience générale, nous avons immunisé des souris exposées au froid, à la RT et à une chaleur élevée avec un vaccin contre le virus de la grippe inactivé au formol et un adjuvant d'aluminium. Contrairement à l'infection pulmonaire par le virus de la grippe (Fig. 1), l'immunisation avec le vaccin contre le virus de la grippe et l'alun a conduit à des anticorps normaux (Annexe SI, illustration S6 UNE et B) et les réponses des lymphocytes T (Annexe SI, illustration S6 C et ) chez des souris fortement exposées à la chaleur. Nous avons ensuite examiné les effets de l'exposition à la chaleur élevée des souris dans l'induction d'une réponse immunitaire adaptative aux agents pathogènes à transmission vectorielle. À cette fin, nous avons infecté des souris RT ou fortement exposées à la chaleur i.p. avec le virus Zika (ZIKV) ou une fièvre sévère avec phlébovirus du syndrome de thrombocytopénie (SFTSV), un virus pathogène humain transmis par les tiques. Nous avons observé des anticorps IgG normaux spécifiques du ZIKV et du SFTSV chez des souris fortement exposées à la chaleur (Annexe SI, illustration S7 UNE et B). En revanche, les cellules CD4 + T productrices d'IFN-γ étaient considérablement réduites chez les souris fortement exposées à la chaleur après i.p. infection par le ZIKV ou le SFTSV (Annexe SI, illustration S7 CH). Ces données suggèrent que les effets de l'exposition à une chaleur élevée des souris dans l'induction de réponses immunitaires adaptatives sont également altérés contre d'autres agents pathogènes viraux.

La composition des bactéries commensales reste intacte chez les souris fortement exposées à la chaleur.

L'exposition au froid des souris entraîne une modification de la composition du microbiote intestinal (21). De plus, un microbiote commensal intact est nécessaire pour les réponses immunitaires adaptatives à l'infection par le virus de la grippe (17, 18). Ces observations nous ont amenés à envisager la possibilité que l'exposition à une chaleur élevée des souris modifie la composition des bactéries commensales, ce qui pourrait atténuer les réponses immunitaires adaptatives à l'infection par le virus de la grippe. Pour tester cette possibilité, nous avons évalué les effets d'une exposition à une chaleur élevée sur la charge bactérienne et la composition dans le caecum. Conformément aux rapports précédents (17, 23), le traitement antibiotique a entraîné des changements importants dans la composition des bactéries commensales (Annexe SI, illustration S8 UNE et B). Les deux fréquence (Annexe SI, illustration S8C) et le nombre (Annexe SI, illustration S8) des cellules CD8 + T spécifiques du virus de la grippe dans les poumons ont diminué chez les souris Abx. Par conséquent, les souris Abx ont augmenté la sensibilité aux doses faibles (50 pfu) et élevées (200 pfu) d'infection par le virus de la grippe (Annexe SI, illustration S8 E et F). En outre, l'inoculation rectale de LPS a restauré les réponses immunitaires à l'infection par le virus de la grippe chez les souris Abx (Annexe SI, illustration S8 gje).

Contrairement aux souris Abx, les souris fortement exposées à la chaleur n'ont pas changé la quantité d'ARNr 16S (Annexe SI, illustration S9UNE) et la composition des bactéries commensales (Annexe SI, illustration S9 B et C) présent dans le caecum. Conformément à un rapport précédent (21), le profilage de la composition du microbiote par séquençage du gène de l'ARNr 16S, suivi d'une analyse des coordonnées principales (PCoA) a révélé un regroupement significativement différent du microbiote dans le caecum des souris exposées au froid qui était distinct de celui de la RT -souris exposées (Annexe SI, illustration S9). En revanche, l'exposition à une chaleur élevée des souris n'a pas modifié de manière significative les amas bactériens dans le caecum (Annexe SI, illustration S9). De plus, l'inoculation rectale de LPS n'a pas rétabli les réponses immunitaires à l'infection par le virus de la grippe chez les souris fortement exposées à la chaleur (Annexe SI, illustration S9 Eg). Ces données indiquent que la stimulation rectale du TLR est insuffisante pour restaurer les réponses immunitaires chez les souris fortement exposées à la chaleur et suggèrent en outre qu'il est peu probable que la composition des bactéries commensales explique les défauts immunitaires chez les souris fortement exposées à la chaleur.

L'autophagie induite par une exposition à une chaleur élevée régule les réponses immunitaires adaptatives à l'infection par le virus de la grippe.

Ensuite, nous avons demandé comment l'exposition à une chaleur élevée des souris supprime la génération d'une immunité adaptative au virus de la grippe dans les poumons. Les souris fortement exposées à la chaleur ont réduit leur apport alimentaire et leur poids corporel de 10 % (Annexe SI, fig. S1). En conséquence, le niveau de la chaîne légère 3 (LC3)-II, un marqueur spécifique de l'autophagosome, a augmenté dans le poumon des souris fortement exposées à la chaleur (Annexe SI, illustration S10 UNE et B). De plus, l'analyse par cytométrie en flux a révélé que les cellules épithéliales CD45.2 − et les DC CD11c + augmentaient significativement l'autophagie dans les poumons de souris fortement exposées à la chaleur (Annexe SI, illustration S10 CE). L'autophagie et la mitophagie restreignent la libération de cytokines dépendantes de l'inflammasome en régulant respectivement les quantités de pro-IL-1β et de mitochondries endommagées (24, 25). Ces observations nous ont amenés à considérer la possibilité que l'exposition à une chaleur élevée des souris induit une autophagie dans les poumons, ce qui inhibe la sécrétion d'IL-1β suite à une infection par le virus de la grippe. Pour déterminer l'importance de l'autophagie dans l'induction de réponses immunitaires adaptatives contre l'infection par le virus de la grippe, nous avons induit l'autophagie in vivo par traitement à la rapamycine ou privation de nutriments par des méthodes établies (26, 27) avant l'infection par le virus de la grippe. Le niveau de LC3-II a augmenté dans les poumons de souris affamées pendant 24 h ou injectées par voie intraveineuse. avec de la rapamycine (Annexe SI, Fig. S11), sans affecter la charge virale dans les poumons à 3 j p.i. (Annexe SI, Fig. S12), la quantité d'ARNr 16S (Annexe SI, illustration S13UNE), la composition du microbiote intestinal (Annexe SI, illustration S13 B et C), ou leurs clusters (Annexe SI, illustration S9). Notamment, l'induction de l'autophagie par privation de nutriments ou le traitement avec la rapamycine a diminué la fréquence (Fig. 2 UNE et B) et le nombre total (Fig. 2 C et ) des cellules CD8 + T spécifiques du virus de la grippe dans le poumon ainsi que l'anticorps IgG spécifique du virus (Fig. 2 E et F). De plus, la sécrétion d'IL-1β mature dans le BALF (Fig. 2g) ainsi que l'expression de l'ARNm de la pro-IL-1β (Fig. 2H) étaient altérées dans les tissus pulmonaires des groupes soumis à une restriction alimentaire ou traités à la rapamycine par rapport aux souris nourries à volonté. Par conséquent, la migration des CD pulmonaires capturées par l'antigène vers le mLN (Fig. 2je et Annexe SI, Fig. S14) ainsi que la prolifération de cellules T CD8 naïves OT-I dans les mLN à 4 et 5 j p.i. (Fig. 2 J et K) ont été réduits dans les groupes soumis à une restriction alimentaire ou traités à la rapamycine. Collectivement, ces données ont indiqué que l'induction de l'autophagie dans les poumons par une exposition à une chaleur élevée a altéré les réponses immunitaires adaptatives à l'infection par le virus de la grippe.

L'autophagie induite par la famine a altéré les réponses immunitaires adaptatives spécifiques au virus de la grippe. Les souris ont été traitées i.v. avec de la rapamycine quotidiennement du jour -2 au jour 9 pendant l'infection ou maintenus dans des conditions de restriction alimentaire ou d'alimentation ad libitum pendant 7 jours avant l'infection par le virus de la grippe (30 pfu par souris) et tout au long de l'infection. (UNE et B) Dix jours plus tard, les lymphocytes ont été isolés du poumon. Des cellules CD8 + T spécifiques du virus de la grippe ont ensuite été détectées en utilisant le tétramère NP du virus de la grippe H-2D b. Les nombres adjacents aux zones délimitées indiquent le pourcentage de cellules CD8 + T tétramères positives. (C et ) Le nombre total de cellules CD8 + T spécifiques du virus de la grippe dans les poumons est indiqué. (E et F) Le sérum a été collecté 10 jours après l'infection. Les taux sériques d'IgG spécifiques au virus de la grippe ont été mesurés par ELISA. (g) Le BALF a été prélevé sur des animaux infectés par le virus de la grippe 2 jours après l'infection. Les niveaux d'IL-1β dans BALF ont été déterminés par ELISA. (H) Les ARN totaux ont été extraits du poumon des souris à 0 et 24 h post-infection. Les niveaux d'ARNm de pro-IL-1β ont été évalués par RT-PCR quantitative. Le GAPDH a été utilisé comme contrôle interne. (je) Des cellules naïves OT-I CD8 + T (1 × 10 5 cellules par puits) ont été co-cultivées avec des CD11c + CD (1 × 10 5 cellules par puits) qui ont été isolées des mLN d'animaux infectés par le virus PR8-OT-I. Des DC spléniques (1 × 10 5 cellules par puits) d'animaux infectés ont été utilisées comme contrôle négatif. Soixante-douze heures plus tard, la production d'IFN-y a été mesurée par ELISA. (J et K) Des souris ont reçu une injection de cellules OT-I CD8 + CD45.1 + T marquées au CFSE la veille de l'infection avec 1 000 pfu de virus PR8-OT-I. Quatre (J) ou 5 (K) d après l'infection par le virus de la grippe, les mLN ont été excisés pour évaluer la prolifération des lymphocytes T par dilution CFSE. Le nombre total de cellules CD8 + CD45.1 + OT-I dans les mLN est indiqué. Les données sont représentatives de deux expériences indépendantes (UNE et B) ou de deux expériences indépendantes (CK moyenne ± SEM). *P < 0.05, **P < 0.01, et ***P < 0,001 n.s., non significatif (ANOVA à un facteur et test de Tukey).

Les signaux provenant de souris nourries à volonté restaurent les réponses immunitaires adaptatives spécifiques au virus de la grippe chez les souris sous-alimentées.

Ensuite, nous avons étudié si les défauts immunitaires chez les souris sous-alimentées pouvaient être sauvés par des signaux provenant de souris nourries à volonté. À cette fin, nous avons joint chirurgicalement des souris nourries à volonté avec CD45.1 + avec des souris sous-alimentées CD45.2 + au moment de l'épreuve du virus de la grippe (Fig. 3UNE). Après le défi, les parabiontes ont été maintenus en condition d'auto-alimentation ad libitum (Fig. 3UNE). Les conditions d'auto-alimentation après l'infection par le virus de la grippe étaient insuffisantes pour restaurer les réponses des cellules CD8 + T spécifiques au virus de la grippe chez les souris sous-alimentées (Annexe SI, fig. S15). Étonnamment, des souris parabiotiques sous-alimentées CD45.2 + ont rejoint chirurgicalement des souris nourries à volonté avec CD45.1 + qui ont restauré les anticorps IgG spécifiques du virus de la grippe (Fig. 3B) et les réponses des lymphocytes T CD8 + dans le poumon (Fig. 3C). De plus, la plupart des cellules T CD8 + spécifiques du virus dans les poumons de souris parabiotiques sous-alimentées se sont avérées être des cellules CD45.2 + dérivées de l'hôte (Fig. 3 et E). De plus, des souris parabiotiques sous-alimentées ont sécrété de l'IL-1β dans l'espace alvéolaire aux niveaux de souris parabiotiques nourries à volonté en réponse à une infection par le virus de la grippe (Fig. 3F). Ces données ont indiqué que les signaux provenant de souris parabiotiques nourries à volonté dans les 10 jours rétablissaient les réponses immunitaires à l'infection par le virus de la grippe chez les souris parabiotiques sous-alimentées par la circulation systémique.

Les signaux provenant de souris nourries à volonté restaurent les défauts immunitaires chez les souris sous-alimentées. (UNE) Les souris ont été maintenues dans des conditions de restriction alimentaire ou d'alimentation ad libitum pendant 7 jours avant l'infection par le virus de la grippe (30 pfu par souris). Des paires de souris C57BL/6 (CD45.2) et ad libitum B6-Ly5.1 (CD45.1) sous-alimentées du même âge ont été jointes chirurgicalement au moment de l'infection et maintenues dans des conditions d'alimentation ad libitum pendant 10 jours. (B) Le sérum a été collecté 10 jours après l'infection. Les taux d'IgG sériques spécifiques du virus de la grippe ont été mesurés par ELISA. (C) Dix jours plus tard, les lymphocytes ont été isolés du poumon. Des cellules CD8 + T spécifiques du virus de la grippe ont ensuite été détectées en utilisant le tétramère NP du virus de la grippe H-2D b. Le nombre total de cellules CD8 + T spécifiques du virus de la grippe dans les poumons est indiqué. () Dix jours plus tard, la présence de cellules CD8 + T CD8 + spécifiques du virus de la grippe dans le poumon de souris parabiotiques a été analysée par cytométrie en flux. (E) Cellules CD8 + T tétramères positives dérivées de l'hôte et du partenaire (m = 12 paires) dans le tissu pulmonaire sont indiqués. (F) Le BALF a été prélevé sur des animaux infectés par le virus de la grippe 2 jours après l'infection. Les niveaux d'IL-1β dans BALF ont été déterminés par ELISA. Les données sont représentatives de deux expériences indépendantes () ou de deux expériences indépendantes (B, C, E, et F moyenne ± SEM). *P < 0.05, **P < 0.01, et ***P < 0,001 n.s., non significatif (ANOVA à un facteur et test de Tukey).

Le glucose et les AGCC restaurent les réponses immunitaires adaptatives spécifiques au virus de la grippe chez les souris fortement exposées à la chaleur.

Jusqu'à présent, nos données ont indiqué qu'un comportement alimentaire réduit altère les cellules T CD8 spécifiques au virus et les réponses en anticorps chez les souris sous-alimentées ou fortement exposées à la chaleur. Une étude récente a démontré que le gavage de glucose protège les souris contre l'infection mortelle par le virus de la grippe (28). De plus, les souris Abx ne parviennent pas à développer des réponses protectrices des cellules CD8 + T après une infection par le virus de la grippe (17) (Annexe SI, fig. S8). Ces résultats nous ont amenés à nous concentrer sur le rôle des AGCC dérivés du glucose ou du microbiote dans l'induction de réponses immunitaires adaptatives à l'infection par le virus de la grippe. Nous avons émis l'hypothèse que l'utilisation du glucose ou les AGCC dérivés de l'alimentation pourraient être nécessaires pour l'induction de l'immunité adaptative induite par l'infection par le virus de la grippe. Pour répondre à ces possibilités, des souris fortement exposées à la chaleur ont reçu 1 M de glucose dans de l'eau potable pendant toute la durée des expériences. Ensuite, nous avons injecté à des souris fortement exposées à la chaleur du glucose i.v. quotidiennement du jour -1 au jour 3 pendant l'infection. Étonnamment, nous avons constaté que i.v. L'injection de glucose a considérablement amélioré la sécrétion d'IL-1β mature dans le BALF, les cellules T CD8 spécifiques du virus de la grippe et les réponses en anticorps chez les souris fortement exposées à la chaleur (Fig. 4 A–C). Injection de souris naïves fortement exposées à la chaleur avec du glucose i.v. n'a pas augmenté la sécrétion d'IL-1β mature dans le BALF (Annexe SI, fig. S16). De plus, la sécrétion d'IL-1β mature dans le BALF et les réponses immunitaires adaptatives spécifiques au virus ont été significativement réduites chez les souris exposées à la RT par le blocage de l'utilisation du glucose avec le 2-désoxy-d-glucose (2DG) (Fig. 4 D–F), suggérant que l'utilisation du glucose est essentielle pour développer des réponses immunitaires adaptatives après une infection respiratoire par le virus de la grippe.

L'utilisation du glucose est nécessaire pour développer une immunité adaptative contre l'infection par le virus de la grippe. (UNEC) Les souris ont été maintenues à 22 °C ou 36 °C pendant 7 jours avant l'infection par le virus de la grippe et tout au long de l'infection. Des souris fortement exposées à la chaleur ont été traitées avec du glucose i.v. tous les jours du jour -1 au jour 3 pendant l'infection. (UNE) Le BALF a été prélevé sur des animaux infectés par le virus de la grippe 2 jours après l'infection. Les niveaux d'IL-1β dans BALF ont été déterminés par ELISA. (B) Dix jours plus tard, les lymphocytes ont été isolés du poumon. Des cellules CD8 + T spécifiques du virus de la grippe ont ensuite été détectées en utilisant le tétramère NP du virus de la grippe H-2D b.Le nombre total de cellules CD8 + T spécifiques du virus de la grippe dans les poumons est indiqué. (C) Le sérum a été collecté 10 jours après l'infection. Les taux d'IgG sériques spécifiques du virus de la grippe ont été mesurés par ELISA. (F) Les souris ont été traitées i.p. avec 2DG quotidiennement du jour -1 au jour 1 () ou 9 (EF) pendant l'infection. () Le BALF a été prélevé sur des animaux infectés par le virus de la grippe 2 jours après l'infection. Les niveaux d'IL-1β dans BALF ont été déterminés par ELISA. (E) Dix jours plus tard, les lymphocytes ont été isolés du poumon. Des cellules CD8 + T spécifiques du virus de la grippe ont ensuite été détectées en utilisant le tétramère NP du virus de la grippe H-2D b. Le nombre total de cellules CD8 + T spécifiques du virus de la grippe dans les poumons est indiqué. (F) Le sérum a été collecté 10 jours après l'infection. Les taux d'IgG sériques spécifiques du virus de la grippe ont été mesurés par ELISA. Les données proviennent de trois (UNEC) ou deux (F) expériences indépendantes (moyenne ± SEM). L'analyse statistique a été réalisée par un test bilatéral de Student. t test (UNEC) ou ANOVA à un facteur et test de Tukey (F). *P < 0.05, **P < 0.01, et ***P < 0,001.

Enfin, nous avons examiné si les AGCC, tels que le butyrate, le propionate et l'acétate, peuvent restaurer les réponses immunitaires au virus de la grippe chez les souris fortement exposées à la chaleur. Un rapport précédent indique que i.v. l'injection de butyrate améliore considérablement la réponse des lymphocytes T CD8 contre le virus de la grippe (20). En effet, l'injection de butyrate a augmenté la sécrétion d'IL-1β mature dans le BALF (Fig. 5UNE), cellules T CD8 spécifiques du virus de la grippe (Fig. 5B) et les réponses en anticorps (Fig. 5C) chez des souris fortement exposées à la chaleur. Remarquablement, la sécrétion d'IL-1β mature dans le BALF (Fig. 5UNE), cellules T CD8 spécifiques du virus de la grippe (Fig. 5B) et les réponses en anticorps (Fig. 5C) ont été partiellement restaurés chez des souris fortement exposées à la chaleur par i.v. injection de propionate ou d'acétate après une infection par le virus de la grippe. Ces données ont collectivement indiqué que l'induction de l'autophagie par une exposition à une chaleur élevée ou une privation de nutriments altère les cellules T CD8 spécifiques au virus et les réponses en anticorps après une infection respiratoire par le virus de la grippe. Dans de telles circonstances, le glucose et les AGCC pourraient être importants pour l'amorçage efficace de la libération de cytokines dépendantes de l'inflammasome et des réponses immunitaires adaptatives après une infection par le virus de la grippe.

Les AGCC ont restauré les réponses immunitaires adaptatives spécifiques au virus de la grippe chez les souris fortement exposées à la chaleur. (UNEC) Les souris ont été maintenues à 22 °C ou 36 °C pendant 7 jours avant l'infection par le virus de la grippe et tout au long de l'infection. Des souris fortement exposées à la chaleur ont reçu du butyrate (200 mM), du propionate (200 mM) ou de l'acétate (200 mM) dans de l'eau potable pendant 7 jours avant l'infection par le virus de la grippe et tout au long de l'infection et traitées avec chaque SCFA i.v. quotidiennement du jour -2 au jour 7 pendant l'infection. (UNE) Le BALF a été prélevé sur des animaux infectés par le virus de la grippe 2 jours après l'infection. Les niveaux d'IL-1β dans BALF ont été déterminés par ELISA. (B) Dix jours plus tard, les lymphocytes ont été isolés du poumon. Des cellules CD8 + T spécifiques du virus de la grippe ont ensuite été détectées en utilisant le tétramère NP du virus de la grippe H-2D b. Le nombre total de cellules CD8 + T spécifiques du virus de la grippe dans les poumons est indiqué. (C) Le sérum a été collecté 10 jours après l'infection. Les taux d'IgG sériques spécifiques du virus de la grippe ont été mesurés par ELISA. Les données sont regroupées à partir de quatre expériences indépendantes (UNE et B moyenne ± SEM). L'analyse statistique a été réalisée par un test bilatéral de Student. t test. *P < 0.05, **P < 0.01, et ***P < 0,001.


Suicide adaptatif : est-il probable qu'un parent choisi entraîne des comportements mortels ?

Alors que plusieurs comportements d'hôtes manipulés sont acceptés comme des phénotypes étendus de parasites, il reste un débat pour savoir si d'autres comportements modifiés chez les hôtes suite à une invasion parasitaire représentent des cas de manipulation parasitaire, de défense de l'hôte ou de pathologie de l'infection. Un sujet particulièrement controversé est le « comportement suicidaire » chez les hôtes infectés. L'hypothèse du suicide de l'hôte propose que la mort de l'hôte profite aux hôtes voués à une fitness directe réduite en protégeant les parents du parasitisme et donc en augmentant la fitness inclusive. Cependant, le suicide adaptatif a été difficile à démontrer de manière concluante en tant qu'adaptation à l'hôte dans les études sur les insectes sociaux ou clonaux, pour lesquels une parenté élevée devrait permettre de plus grands avantages pour la condition physique inclusive. Suite à la discussion des travaux empiriques et théoriques du point de vue de l'écologie comportementale, cette revue constate que la preuve la plus convaincante pour la sélection du suicide adaptatif provient des bactéries. Malgré l'accent mis sur les parasites, motivé par la littérature existante, le potentiel d'évolution du comportement suicidaire adaptatif chez les hôtes est également considéré comme s'appliquant aux cas d'infection par des agents pathogènes, à condition que la maladie ait un effet sévère sur la forme physique directe et que le comportement suicidaire peut affecter la dynamique de transmission des agents pathogènes. Des suggestions sont faites pour de futures recherches et un élargissement des implications possibles pour la coévolution entre les parasites et les hôtes.

1. Introduction

Dans tous les taxons impliqués dans les relations parasite-hôte, une gamme de mécanismes d'exploitation et de défense ont co-évolué dans les "côtés" respectifs. Une question clé est de savoir si certains des comportements affichés par les animaux parasités représentent des adaptations de l'hôte ou de son parasite [1]. Les changements de comportement à la suite d'une invasion parasitaire varient considérablement dans leur ampleur [2] et la signification adaptative, le cas échéant, n'est pas toujours claire. Une possibilité est que les comportements modifiés peuvent simplement être une réponse aux effets pathologiques des parasites et ne sont pas nécessairement adaptatifs au parasite ou à l'hôte. Cependant, Moore [3] met en garde contre l'explication des comportements modifiés comme des « effets secondaires » de la « pathologie », arguant que les résultats de fitness pour les participants aux associations hôte-parasite, y compris les modifications comportementales induites par les parasites, seront soumis à la sélection naturelle et, par conséquent, nous devraient s'attendre à ce qu'ils soient plus vraisemblablement qu'improbablement liés à l'évolution des espèces concernées. La plupart du temps, cependant, les études se concentrent sur l'attribution des comportements à l'adaptation du parasite ou à l'adaptation de l'hôte.

D'une part, si les comportements modifiés de l'hôte s'adaptent aux parasites, ils devraient faciliter l'achèvement de leur cycle de vie. Ceci est généralement réalisé soit en détournant l'énergie de l'hôte de sa propre reproduction vers le parasite pour la croissance [3-6] ou en rendant les hôtes intermédiaires plus vulnérables à l'ingestion par l'hôte définitif du parasite [3,7-10]. Lorsque le cycle de vie des parasites implique des étapes qui passent un certain temps dans un environnement externe particulier, le comportement de l'hôte peut également être manipulé pour une dispersion réussie des propagules du parasite dans leurs conditions les plus appropriées [1,3,11-13]. Fait intéressant, Poulin et al. [14] suggèrent que les hôtes peuvent être capables de s'opposer à certaines manipulations comportementales par des parasites établis, mais l'idée a reçu peu d'attention. Certaines réponses de l'hôte à l'infection par les helminthes suggèrent que certains hôtes peuvent rester au moins partiellement responsables de leur corps, mais le manque de données n'est pas surprenant car là où les hôtes infectés se comportent normalement, l'opposition à la manipulation ne serait pas différenciable de l'échec d'un parasite à manipuler [14 ].

D'autre part, les hôtes peuvent bénéficier de changements de comportement suite au parasitisme. De toute évidence, les comportements qui servent à minimiser les dommages causés par un parasite interne peuvent réduire l'impact négatif du parasitisme sur un hôte, comme un comportement de maladie [15], une fièvre comportementale [16,17] ou une auto-médication de nourriture [18,19] . Plus intrigant, un individu hôte peut bénéficier en sacrifiant sa forme physique directe pour augmenter sa forme physique inclusive [20,21]. Un mécanisme fascinant, mais controversé, par lequel cela pourrait se produire sont les comportements dits de «suicide adaptatif», où les comportements post-invasion fonctionnent pour éliminer la propagation d'un parasite établi, protégeant ainsi la famille [22,23].

2. Suicide adaptatif

L'hypothèse du suicide de l'hôte [22] propose qu'un hôte puisse utiliser sa propre mort pour augmenter sa forme physique inclusive [20,21]. Lorsqu'une infection parasitaire provoque effectivement la stérilité ou la mort, l'hôte sera incapable d'améliorer sa propre aptitude reproductive. Le coût de remise en forme associé à la mort devient négligeable lorsque la propre reproduction attendue d'un hôte approche de zéro [23]. A condition que la mort de l'hôte (et celle de son parasite) réduise le niveau de parasitisme ultérieur chez ses parents par rapport à celui des non-parents, il devrait y avoir une valeur de sélection positive sur le comportement. Smith [22] a soutenu que la sélection naturelle devrait conduire l'évolution du comportement suicidaire même lorsque les augmentations de la fitness inclusive sont très faibles, à condition que : (i) la fitness individuelle de l'hôte soit nulle, (ii) lors de l'émergence de l'hôte, les parasitoïdes sont plus susceptibles d'infecter les parents de l'hôte que les non-parents, et (iii) le succès de reproduction des parents est accru en raison du risque réduit de parasitisme qui s'ensuit.

Afin de satisfaire ces exigences, le suicide adaptatif était prédit comme étant plus fréquent chez les espèces hôtes coloniales ou sociales, ou chez les membres de populations hôtes avec de faibles taux de dispersion et un degré relativement élevé de consanguinité [22]. Inversement, les espèces de parasitoïdes avec des zones de recherche ou des zones de découverte relativement petites seraient particulièrement vulnérables si leurs hôtes adoptaient ce comportement [22]. Le comportement suicidaire peut inclure une activité qui rend l'individu plus visible pour les prédateurs ou plus facile à capturer [22], ou entraîne des coûts importants en termes d'énergie dépensée, d'opportunités d'alimentation perdues et de probabilité de décès [23].

3. Travail empirique

(a) Insectes en agrégation : pucerons

McAllister & Roitberg [23] ont rapporté ce qu'ils pensaient être la première preuve convaincante à l'appui de l'hypothèse du suicide de l'hôte de Smith [22], à la suite de leurs observations de pucerons du pois (Acyrthosiphon pisum) de différentes régions parasitées par la guêpe braconide Aphidius ervi manifester apparemment un comportement suicidaire à des degrés divers. En réponse à la fois à la phéromone d'alarme contre les pucerons et à l'approche des prédateurs de coccinellidés, les pucerons pour lesquels le risque de décès dû au stress thermique et à la dessiccation était considéré comme plus élevé ont chuté plus fréquemment lorsqu'ils sont parasités, tandis que les pucerons des régions côtières plus froides ne se comportent pas différemment lorsqu'ils sont parasités se forment lorsqu'ils ne sont pas parasités. 23]. À partir de cela, McAllister & Roitberg ont conclu que dans un habitat où les tactiques d'évasion alternatives entraînent des différences significatives dans le risque de mortalité (régions intérieures), les pucerons parasités ont choisi le comportement le plus risqué. Pendant ce temps, dans l'habitat où les tactiques de fuite alternatives n'entraînent aucune différence apparente dans le risque de mortalité (régions côtières), les pucerons parasités ne se comportaient pas différemment des pucerons non parasités. Curieusement, cependant, dans les deux situations, les pucerons parasités ne sont pas tombés des plantes sans médiation par la prédation [23]. Cette étude a reçu un certain nombre de critiques de Latta [24] et Tomlinson [25] que McAllister & Roitberg [26] ont qualifiées de « malentendus » dans une réfutation, mais le fait que le suicide adaptatif dans ce système ait été médié par un prédateur suggère sans doute que le l'adaptation concerne plus la survie du parasitoïde qu'un bénéfice pour le puceron. Si ce n'est pas le cas, il est peu logique que les pucerons ne se laissent pas consommer par des prédateurs. En effet, nous trouvons dans certains cas plus récents – discutés plus en détail plus loin – que l'augmentation de la mobilité suite à l'invasion d'un parasite peut augmenter la probabilité qu'un puceron soit consommé par un prédateur [27-29].

McAllister et al. a ensuite examiné le suicide adaptatif chez des pucerons du pois parasités ayant un potentiel de reproduction variable [30]. Lorsque les pucerons sont parasités au deuxième stade larvaire, ils n'ont pas d'avenir reproducteur et ne produiront aucune progéniture avant la momification. Cependant, les pucerons parasités à leur quatrième stade peuvent s'attendre à produire sept à huit petits avant de mourir, ce qui augmente directement leur propre forme physique. Les pucerons parasités au deuxième stade se sont avérés adopter un comportement d'évasion dangereux (chute) lorsqu'ils sont approchés par un prédateur, tandis que les pucerons parasités à leur quatrième stade ne se comportaient pas différemment des individus non parasités [30]. Ce résultat était cohérent avec la prédiction de McAllister & Roitberg selon laquelle, à mesure que le coût du comportement altruiste augmente par rapport au gain de fitness inclusif, le comportement suicidaire devrait disparaître. adaptation bénéfique pour l'hôte [30].

De nombreuses espèces de pucerons se dispersent loin de leurs compagnons de colonie et se momifient ailleurs à la suite d'un parasitisme, mais il n'y a pas toujours de preuves suggérant que ce comportement est médié par l'hôte ou le parasitoïde [31,32]. Il est également possible que le parasitoïde et l'hôte en bénéficient dans une certaine mesure. Peut-être que l'hôte obtient des avantages indirects en matière de fitness en transportant le parasitoïde loin de sa famille, tandis que le parasite n'en souffre pas tant qu'il n'est pas plus difficile de trouver des pucerons (non apparentés). De plus, le parasitoïde pourrait en fait bénéficier si le passage à un microclimat plus sûr [33]. Considérant d'autres preuves potentielles d'altruisme chez les pucerons non eusociaux à reproduction parthénogénétique, Wu et al. [34] se sont penchés sur l'étalement des sécrétions de la cornicule par les pucerons des céréales (Sitobion avenae) sur les parasitoïdes (Aphidius rhopalosiphi). Il a été conclu que les sécrétions corniculaires des pucerons étaient altruistes contre les parasitoïdes, car elles n'apportaient aucun avantage direct sur la forme physique aux individus libérant des sécrétions, mais uniquement des avantages indirects sur la forme physique en impactant négativement le temps de recherche de nourriture ultérieur du parasitoïde et en offrant une certaine protection aux clones voisins [34]. Le frottis se produisait également plus fréquemment lorsqu'un plus grand nombre de partenaires clones étaient présents, augmentant les avantages inclusifs pour la condition physique [34]. Cela semble être un cas de défense altruiste dirigée par les parents en dehors des animaux eusociaux. Il est intéressant de noter que les pucerons non sociaux semblent également posséder des capacités surprenantes de reconnaissance de la parenté, dont les capacités d'agrégation et de défense varient en fonction de la présence relative de compagnons clones et de non-parents [35].

Avec une prise de conscience accrue du potentiel des pucerons à reconnaître la parenté, il est intéressant de considérer que le suicide adaptatif à la suite d'un parasitisme en présence de prédateurs n'implique pas nécessairement de quitter ou de quitter une zone pour éliminer de manière altruiste un parasite. Meisner et al. [27] ont démontré que les pucerons du pois aux premiers stades du parasitisme subissent une plus grande prédation par le prédateur coccinellide Harmonia axyridis que les pucerons non parasités. Duran Prieto et al. [28] ont proposé que si le comportement des pucerons parasités était la cause de leur prédation plus intense, il fallait s'attendre à ce que les pucerons parasités subissent une plus grande prédation de la part de prédateurs autres que les coccinellidés, surtout si leur comportement a une valeur adaptative. Ces auteurs ont exploré la prédation des pucerons du pois récemment parasités par l'hémiptère Macrolophus pygmaeus, obtenant un résultat similaire à Meisner et al. [27]. Comme le taux de prédation n'était pas affecté par le rapport pucerons parasités/pucerons non parasités, l'énergie et la nutrition obtenues à partir des deux types de proies peuvent être supposées être égales et, par conséquent, la préférence des proies était probablement due au comportement des pucerons plutôt qu'à la physiologie. Une mobilité plus élevée après avoir été parasitée était évidente. Il est donc plausible que le comportement suicidaire observé chez le puceron du pois suite à un parasitisme [23,30] puisse fonctionner en augmentant le taux de rencontre entre le prédateur et la proie parasitée [28]. En s'offrant de manière comportementale et en éliminant le parasite de la zone parasitée, les hôtes peuvent aider à rassasier les prédateurs afin de protéger les parents non parasités. Cette hypothèse est étayée par l'observation de Meyhofer & Klug [29] qu'un prédateur de chrysope, Chrysoperla carnea, a pris beaucoup moins de temps pour capturer un puceron noir du haricot parasité (Aphis fabae) comme sa prochaine victime qu'une non parasitée.

(b) Insectes eusociaux : abeilles et fourmis

Schmid-Hempel & Müller [36] ont rapporté que le travailleur Bombus lucorum les bourdons parasités par les mouches conopidés restent en dehors du nid plus longtemps que les ouvrières non parasitées pendant les heures de recherche de nourriture et peuvent abandonner complètement le nid. Ils ont suggéré que cela profiterait aux pupes de parasitoïdes car elles pourraient être moins sujettes aux infections qui peuvent se développer sur les rayons abandonnés dans les colonies de bourdons. Cependant, Poulin [37] a suggéré que ces changements de comportement sont plus vraisemblablement une réponse adaptative de l'hôte, entraînant une forme physique inclusive, et donc un exemple du suicide adaptatif de l'hôte proposé par Smith [22]. Fritz [38] a souligné que la sélection naturelle devrait favoriser les parasitoïdes qui manipulent l'hôte de manière à réduire sa probabilité de mortalité avant la pupe du parasitoïde, mais les bourdons seraient en fait plus sensibles à la prédation, à la famine et au superparasitisme en dehors du nid [37].

Cependant, l'association conopidés-bourdons ne remplit pas les conditions du suicide adaptatif de l'hôte telles que définies par Smith [22] pour deux raisons : (i) au moment où les conopidés adultes émergent des pupes, les parents de l'hôte se sont dispersés ou sont morts (ii) les femelles conopidés adultes se sont largement répandues loin de leur site d'émergence et n'infecteraient donc pas préférentiellement la famille du bourdon même si le bourdon lui permettait de vivre [37]. McAllister et al. [30], cependant, ont souligné que la mort précoce d'un hôte parasité sera adaptative tant que le coût d'une diminution du succès de reproduction est compensé par les avantages d'une meilleure forme physique inclusive. Poulin [37] a soutenu que le coût de la mort d'un bourdon ouvrière parasité est en fait très faible puisque son potentiel reproducteur se rapproche de zéro après l'infection, tout comme son utilisation comme butineuse dans la colonie. D'un autre côté, quitter le nid pourrait augmenter la valeur adaptative inclusive d'une abeille car les ouvrières parasitées sont susceptibles d'être attaquées davantage par les mouches conopides, et donc quitter la colonie peut attirer les attaques de mouches loin des parents non parasités [37]. De plus, en quittant un nid, une abeille parasitée avec une efficacité de recherche de nourriture plus faible pourrait éviter d'épuiser les réserves de nourriture de la colonie pour sa propre survie improductive, laissant ainsi plus de disponibilité pour sa famille [37] - un comportement que nous appelons ici « l'effet du capitaine Oates ». .

L'interprétation de Poulin [37], cependant, a été critiquée dans la réponse de Müller & Schmid-Hempel [39]. Les bourdons ont tendance à se mêler aux butineuses de nombreuses colonies différentes lorsqu'ils sont en dehors de leurs nids, et donc rester à l'extérieur de la colonie et agir comme cible pour les attaques de mouches est très susceptible de protéger les parents et les non-parents du parasitisme à des degrés similaires, les avantages ne seraient pas disproportionnés. dirigé vers la parenté dans la mesure où l'hypothèse de la sélection de la parenté l'exige [39]. Müller & Schmid-Hempel [39] ont également fait valoir que, d'après leurs observations, il n'y a aucune preuve que les bourdons parasités ne sont pas capables de se nourrir de fleurs et qu'ils ne dépendraient donc pas nécessairement des réserves de nourriture de la ruche de toute façon. Müller & Schmid-Hempel [40] ont par la suite trouvé des preuves de bourdons parasités exploitant les températures froides comme défense contre les parasitoïdes. Les ouvrières parasitées restaient sur le terrain pendant la nuit au lieu de leur nid, les températures froides à l'extérieur du nid pouvaient retarder la maturation du parasite, réduisant ainsi ses chances de développement réussi. Dans des expériences de choix, il a également été démontré que les abeilles parasitées recherchaient activement des températures froides [40] bien que ne soutenant pas le suicide adaptatif, ces résultats suggèrent un rôle plus important pour l'avantage de l'hôte plutôt que la manipulation pure du parasite.

Sans rapport avec le parasitisme, une auto-élimination apparemment altruiste de la ruche a été signalée chez des abeilles domestiques dont la santé est compromise (Apis mellifera), dont la présence peut être nocive pour leur colonie [41]. D'autres études ont précédemment suggéré que différents insectes eusociaux quittent définitivement leurs colonies lorsqu'ils sont infectés [42,43], mais il est difficile de distinguer l'adaptation de l'hôte d'une potentielle manipulation parasitaire, voire d'un traumatisme pathologique. En compromettant artificiellement les butineuses d'abeilles, Rueppell et al. [41] ont fourni des preuves expérimentales que l'auto-élimination n'a pas besoin d'être causée directement par une manipulation parasitaire ou liée à la recherche de nourriture induite par le stress [44] ou à la perte des capacités d'orientation [43] l'auto-élimination altruiste pourrait être une adaptation de l'hôte pour augmenter la forme physique inclusive. De plus, un modèle simple a suggéré que l'auto-élimination altruiste par les travailleurs sociaux malades des insectes, afin de prévenir la transmission de la maladie à la famille, est attendue dans la plupart des conditions biologiquement plausibles [41]. Lorsqu'il survient après une infection par un parasite, l'auto-élimination d'une colonie peut dans certains cas être qualifiée de suicide adaptatif.

Cependant, la désertion des colonies suite au parasitisme ne vient certainement pas toujours de l'altruisme. Hugues et al. [45] décrivent un changement de comportement fascinant chez la guêpe papier Polistes dominulus suite à une infection par le parasite strepsipteran Xenos vesparum qui aboutit à la désertion de la colonie et à la formation de groupes extranidaux dans lesquels jusqu'à 95 % des occupants sont des femelles parasitées. Alors que la désertion altruiste pour réduire l'infection des parents serait généralement une bonne stratégie pour les insectes sociaux infectés, cela est intenable dans ce cas parce que les femelles X. vesparum les parasites ne sont infectieux que s'ils sont inséminés et la copulation des guêpes ne se produit pas sur le nid du fait que les occupants attaquent vigoureusement les mâles libres. La désertion et l'agrégation du nid par les guêpes infectées sont très probablement un cas de manipulation adaptative du comportement de l'hôte par le parasite afin de faciliter l'accouplement du parasite [45].

Comme chez les pucerons [27-29], cependant, le suicide adaptatif chez les insectes eusociaux peut ne pas toujours impliquer la séparation spatiale d'un hôte de sa parenté. Mathis & Tsutsui [46] ont étudié le staphylin Myrmedonota xipe, qui s'associe à—généralement très agressif—Azteca sericeasur fourmis. On a trouvé que les staphylins localisaient sélectivement et s'attaquaient aux fourmis parasitées par les mouches parasitoïdes phoridées. Les fourmis parasitées ont agi de manière moins agressive envers les coléoptères que les fourmis saines, ce qui signifie que les staphylins peuvent les manger vivants sans interruption [46]. Incapable d'accéder aux fourmis agressives et non parasitées comme ressource alimentaire, M. xipe semblaient presque exclusivement s'attaquer aux fourmis parasitées, mais cela pourrait également profiter aux fourmis infectées, car leur consommation réduirait la population de mouches phoridées libres d'infecter leurs proches. D'une part, ce système semble un bon candidat pour répondre aux critères de l'hypothèse hôte-suicide, car A. sericeasur est un insecte social polygyne et polydome qui forme de vastes territoires et donc les parasitoïdes matures émergents sont beaucoup plus susceptibles de rencontrer les parents de leur hôte que les non-parents [46]. D'un autre côté, il se peut que toutes les larves de mouches phoridées ne parviennent pas à maturité, et donc la prédation sélective des fourmis qui survivraient au parasitisme coûterait finalement à la colonie dans son ensemble [46]. Les ouvrières parasitées peuvent également être des membres actifs de la colonie pendant le développement du parasitoïde, et dans ces cas, le bénéfice de l'élimination des larves par prédation peut être compensé par les coûts pour la colonie encourus par la perte des ouvrières parasitées productives [46]. D'autres travaux explorant les véritables coûts et avantages de la prédation sélective des staphylins sur les fourmis parasitées permettront certainement de mieux comprendre l'évolution de ce système, mais, comme le concluent Mathis & Tsutsui, la prédation des dendroctones peut indirectement bénéficier aux fourmis là où les fourmis parasitées peuvent réduire le nombre de parasitoïdes en augmentant leur attrait en tant que proie. La prédation sélective sur les hôtes parasités, au-delà des pucerons, a été démontrée dans plusieurs études, notamment chez les lépidoptères [47] et les hyménoptères non eusociaux [48] (voir aussi la revue de Rosenheim et al. [49]) explorer la possibilité de cela en tant que stratégie préventive de suicide adaptative à travers différents taxons sera également utile pour faire progresser la compréhension des réponses au parasitisme.

(c) Bactéries

Une stratégie immunitaire défensive extrême chez les bactéries contre les phages est le déploiement de systèmes d'infection abortive (Abi) qui interrompent l'infection par le phage mais conduisent également à la mort de la cellule bactérienne infectée [50]. Les systèmes Abi protègent les bactéries voisines au détriment de l'individu exprimant le trait [51]. Le déploiement altruiste des systèmes Abi est particulièrement susceptible d'être sélectionné lorsque les cellules voisines d'une bactérie sont issues de l'expansion clonale ou, en plus ou en alternative, les cellules ont d'autres facteurs qui favorisent la coopération, tels que l'agrégation dans le cadre d'un biofilm [52,53] . Makarova et al. [52] ont émis l'hypothèse que les systèmes d'immunité et de suicide chez les bactéries sont couplés et qu'une prise de décision complexe impliquant la détection de l'évolution d'une infection virale peut déterminer si la réponse à un virus implique l'induction d'une dormance, une réponse immunitaire ou un suicide face à défaillance du système immunitaire. Les travaux sur les systèmes CRISPR-Cas de classe 2 récemment découverts (Clustered Regularly Interspaced Palindromic Repeats and CRISPR-associated genes) [54-56] ont depuis trouvé le lien le plus direct entre l'immunité et la mort cellulaire programmée chez les microbes découvert à ce jour [57]. On pense que le couplage immunité-suicide est favorisé dans les situations où un système comprend des composants à double fonction qui sont impliqués à la fois dans les activités immunitaires et suicidaires [58] cela pourrait être le cas pour certaines protéines Cas [57].

La « décision » de commettre un suicide adaptatif chez les bactéries implique probablement diverses voies de transduction du signal [52]. Dans les cellules de levure eucaryotes (Saccharomyces cerevisiae), on pense que la mort cellulaire programmée naturelle dépend du degré d'endommagement du matériel génétique, sa valeur critique étant déterminée par la machinerie de détection de quorum [59]. Le quorum-sensing est également un processus important dans la communication cellule-cellule des bactéries procaryotes, dans lequel des molécules de signalisation extracellulaires sont produites, détectées et traitées [60,61]. Le quorum sensing s'est avéré important dans la décision de compétence en sporulation chez Bacillus subtilis [62,63], et Hazan et al. [64] ont récemment décrit un nouveau mécanisme bactérien régulé par quorum-sensing qui contrôle l'auto-empoisonnement de la chaîne respiratoire chez Pseudomonas aeruginosa, fournissant un avantage de remise en forme au collectif microbien. Un mécanisme impliquant le quorum sensing est susceptible d'être un élément important dans la mécanique de la mort cellulaire adaptative suite à une infection bactérienne [52].

Au-delà de la détection des niveaux de population par détection du quorum, les protéines capables de détecter les dommages et de «prédire» l'issue des infections seront également importantes dans la médiation des systèmes Abi et des toxines-antitoxines [65,66] qui colocalisent avec les gènes de l'immunité [57]. Les mécanismes et les structures exacts qui prédisent l'évolution des infections virales restent à élucider, mais on pense que chaque fois que des molécules de capteur dédiées indiquent qu'une attaque est gérable, la cellule mobilise son système immunitaire, tandis que si les indications d'attaque sont graves, alors elle-même les programmes affligeants sont déclenchés [57]. Le passage du mode immunitaire au mode de défense suicidaire peut être en partie gouverné par des capteurs déterminant le niveau de dommages infligés à une cellule [57]. Curieusement, cependant, les systèmes CRISPR-Cas de type VI-A semblent prendre un raccourci dans le relais de réponse habituel de la cellule en simplifiant - voire en sautant - l'étape de détection des dommages et en utilisant également l'effecteur immunitaire principal comme effecteur suicide, mais ces systèmes sont rares chez les bactéries, ce qui suggère peut-être que la détection des dommages précédente est coûteuse [57]. Les signaux prédictifs et de détection de dommages lus et répondus par divers capteurs diffèrent probablement entre les systèmes de défense (voir [57] et les références qui y figurent pour plus de détails).

Plusieurs études suggèrent que la structure spatiale et la migration sont importantes pour l'évolution du suicide bactérien lors de l'infection car elles ont un impact sur la parenté et donc sur les avantages relatifs de la sélection de la parenté [67-71]. Par exemple, Fukuyo et al. [69] rivalisait altruiste Escherichia coli avec un mécanisme de suicide artificiellement conçu contre les bactéries de type sauvage en présence ou en l'absence du phage λ. Ils ont découvert que dans un environnement de gélose molle à structure spatiale, le suicide altruiste avait un avantage sélectif pour les bactéries, mais ce n'était pas le cas dans un environnement liquide bien mélangé. Utilisation du mécanisme Abi naturel « Lit » dans E. coli, Berngruber et al. [67] ont varié la quantité de mélange dans les environnements de manière plus continue et ont constaté à nouveau qu'une structuration spatiale était nécessaire pour l'évolution du suicide altruiste, mais aussi que trop peu de mélange pouvait empêcher l'évolution d'une infection abortive en raison de la propagation réduite du parasite dans ces conditions. Une autre étude de Refardt et al. [70] ont confirmé ces résultats en utilisant le système Abi le mieux caractérisé, ‘Rex’ in λ-lysogenic E. coli souches [50]. Refardft et al. [70] ont démontré que le suicide adaptatif peut évoluer même lorsque la similarité génétique entre souches voisines est relativement faible dans leur étude de E. coli répondre à l'attaque d'un phage obligatoirement lytique.

4. Travaux théoriques et prédictions évolutives

Comme discuté ci-dessus, les interprétations des données empiriques qui soutiennent l'hypothèse du suicide de l'hôte [23,28,30,37] ont souvent été critiquées [24,25,39]. L'importance adaptative du suicide de l'hôte en particulier a été contestée car les principales études de soutien impliquaient des pucerons clonaux qui agrègent [23,30] ou des hyménoptères eusociaux [36], où des histoires de vie complexes ont rendu difficile l'exclusion d'explications alternatives ou la réalisation d'analyses rigoureuses. de la condition physique [70]. Même dans Euphydryas phaéton chenilles et leurs parasitoïdes - suggéré par Smith [22] comme système approprié pour tester l'hypothèse du suicide de l'hôte - le suicide adaptatif n'a pas encore été démontré comme étant plus plausible que les changements de comportement servant à augmenter les chances du parasitoïde d'échapper à la prédation et au parasitisme lui-même [72]. Pourtant, des travaux théoriques ont révélé de manière convaincante les conditions requises pour que le suicide de l'hôte évolue [22,30,71].

L'hypothèse originale de Smith [22] suggérait logiquement que les comportements suicidaires adaptatifs augmenteraient la fitness inclusive d'un hôte parasité si les conditions suivantes étaient remplies : (i) le comportement suicidaire empêche la maturation et l'émergence du parasite (ii) le parasite mature est plus susceptible d'infecter parents de l'hôte que les non-parents et (iii) le bénéfice pour l'hôte, en termes d'aptitude accrue du parent, est supérieur au coût du suicide, mesuré en termes de perte de l'aptitude reproductive de l'hôte. Si toutes ces conditions ne sont pas remplies, la mort précoce de l'hôte peut toujours être adaptative tant que les coûts d'une diminution du succès de reproduction sont compensés par les avantages inclusifs de la condition physique [30]. L'un des points clés ici est peut-être que l'infection parasitaire doit avoir une conséquence grave, voire mortelle, pour le succès reproducteur futur de l'hôte afin de garantir que l'échange des avantages directs de la forme physique contre des avantages sélectionnés par la famille entraînerait un gain net pour l'hôte infecté. . Debarre et al. [71] ont illustré via la modélisation comment le suicide sur infection peut être une adaptation, mais uniquement en réponse à des parasites extrêmement nocifs et dans des environnements spatialement structurés.

Shorter & Rueppell [73] a suggéré que les insectes eusociaux, plutôt que de simples insectes clonaux agrégés, peuvent fournir les meilleurs systèmes de test pour le suicide adaptatif en raison de la grande parenté et de la force relative de la sélection de la parenté. Bien que cela puisse s'avérer vrai, les travaux empiriques sur les bactéries semblent jusqu'à présent apporter le plus grand soutien au suicide adaptatif, même dans des conditions de parenté relativement faible. Là où le suicide a un coût très faible pour les auteurs dans des environnements structurés, car les cellules infectées sont moribondes sans possibilité de reproduction ultérieure, un altruisme apparent peut évoluer si un tel acte procure un grand avantage aux survivants qui évitent alors l'extinction [70]. Inversement, dans des environnements non structurés, le suicide sacrificiel serait vain car il ne protégerait pas préférentiellement les proches et donc dans ces situations, la résistance individuelle est la meilleure tactique pour les bactéries pour combattre les phages [68].

La sélection pour le suicide adaptatif chez les bactéries sera probablement également affectée par des facteurs écologiques. Refardt & Kümmerli [68] ont découvert que dans les environnements structurés, la défense de l'hôte suicidaire était légèrement moins efficace que la résistance individuelle pour résister aux phages. Ils ont proposé que l'efficacité plus faible supposée de l'infection abortive pourrait être compensée par un manque de coûts pléiotropes par rapport à ceux généralement associés aux mécanismes de résistance individuels. Lion & Gandon [74] suggèrent en outre que la sélection pour le suicide altruiste devrait être maximisée à une faible dispersion de l'hôte et à une dispersion intermédiaire des parasites, en raison de leurs rôles dans la structuration spatiale. Le transfert horizontal du suicide altruiste Les systèmes Abi peuvent également jouer un rôle important dans leur succès évolutif [74]. Cependant, on ne sait pas encore comment le suicide adaptatif peut supplanter les stratégies de défense bactériennes plus simples empêchant l'infection initiale [74] et la sélection des comportements suicidaires adaptatifs n'a pas encore été démontrée de manière convaincante dans des organismes plus complexes.

S'il existe des cas où des comportements suicidaires seront sélectionnés chez des hôtes infectés, cela soulève la question de savoir comment le suicide adaptatif persiste au cours de l'évolution si l'espèce parasite perdrait systématiquement. L'un des problèmes de Tomlinson [25] avec la première étude de McAllister & Roitberg concernant le suicide adaptatif chez les pucerons [23] était que la sélection naturelle sur les parasites favoriserait la subversion d'un tel comportement suicidaire qui profitait à leurs hôtes, et que "dans toute "course aux armements" , les asymétries de sélection devraient favoriser le parasite ». Ventilateur et al. [75] décrivent un moyen fascinant par lequel un bactériophage contre-évolue pour éviter que sa réplication ne soit bloquée par le suicide prématuré d'une cellule infectée. Ici, ils ont trouvé les séquences évolutives du bactériophage qui imitaient l'antidote de la cellule à ses propres toxines, lui permettant de continuer à se répliquer sans être détruite par le système défensif de son hôte. Cependant, il existe en fait certaines conditions dans lesquelles la sélection sur un parasite pourrait ne pas être en mesure de remplacer la sélection pour un comportement suicidaire bénéfique pour l'hôte. Premièrement, si le comportement suicidaire est déclenché par un ensemble complexe de stimuli, la probabilité qu'une sélection pour la variation des traits du parasite puisse se produire juste dans le but de subvertir un comportement aussi complexe est peut-être très faible [26]. Deuxièmement, dans les situations où les coûts du maintien d'un contrôle aussi fort sur les hôtes seraient élevés par rapport au gain, les parasitoïdes peuvent ne pas être sélectionnés pour surmonter les comportements de l'hôte. McAllister & Roitberg [26] donnent l'exemple de parasites avec une fécondité exceptionnellement élevée, pour lesquels le coût de fournir à chaque progéniture suffisamment de neurotoxines pour modifier le comportement de chaque hôte serait excessivement élevé.

Il convient également de se demander si les interactions hôte-parasite peuvent avoir coévolué au fil du temps, de sorte que les comportements suicidaires chez les hôtes peuvent parfois profiter à la fois à l'hôte et à son parasite. Comme mentionné précédemment, il nous semble plausible qu'il puisse y avoir des cas où un parasite soit neutre envers ou puisse bénéficier d'un hôte infecté laissant tomber ou s'éloignant de sa parenté. Tant qu'il est possible de rencontrer des hôtes de quelque sorte, parents ou non, après son émergence, le parasitoïde n'a pas besoin de perdre le comportement de l'hôte, tandis que l'hôte gagne toujours des avantages de fitness inclusifs en protégeant ses parents. En fait, si l'éloignement de la famille de l'hôte déplace également la progéniture du parasitoïde vers un microclimat plus sûr pour la maturation et l'émergence, alors peut-être que les deux « côtés » de l'interaction bénéficient des comportements modifiés. Il n'est pas non plus exagéré de considérer que certains des cas où les hôtes infectés se rendent plus vulnérables à la prédation, soit par un comportement visible, soit par des déplacements vers des lieux particuliers, pourraient aider les parasites avec des histoires de vie particulières qui nécessitent une transmission de l'hôte intermédiaire à l'hôte définitif. tout en rassasiant les prédateurs pour protéger la famille de l'hôte. Bien qu'il soit difficile de déterminer si la parenté d'un hôte bénéficie réellement de ce genre de scénarios, étant donné que le parasite réussit manifestement à être transmis à son hôte définitif, nous considérons qu'il est probable que le bénéfice du comportement d'un hôte pour l'hôte ou le parasitoïde dépend du contexte. À titre d'exemple, l'abandon du nid par les bourdons pourrait profiter davantage à l'hôte qu'au parasite dans les cas où le parasite est très abondant et virulent et où les comportements de nettoyage du nid seront dépassés, ce qui est discuté plus en détail dans la section suivante.Il est important que toute la dynamique de la population en jeu soit prise en compte dans la mesure du possible.

5. Dans quelles situations le suicide adaptatif peut-il évoluer ?

Bien que cet article se soit concentré sur les adaptations de l'hôte à la suite d'une infection par des parasites, car les travaux antérieurs dans ce domaine se sont concentrés sur le parasitisme, nous ne voyons aucune raison pour laquelle les cas d'infection par la maladie ne devraient pas également conduire à l'évolution de comportements suicidaires qui profitent à la hôtes. L'aspect clé des maladies et des parasites qui peuvent potentiellement provoquer l'évolution du suicide adaptatif de l'hôte est qu'ils doivent avoir un effet sévère sur la fitness directe, sinon il est peu probable qu'un comportement évolue pour compromettre la fitness directe afin de stimuler la fitness indirecte. L'un des principaux moyens par lesquels les agents pathogènes ou les parasites peuvent avoir un impact direct sur la valeur adaptative est d'être hautement virulent. Si la virulence n'est pas élevée, alors un comportement qui sacrifie la fitness directe d'un hôte pour favoriser l'amélioration de la fitness indirecte n'évoluerait pas. Si la virulence est élevée, l'évolution de ce comportement est plus probable, mais le comportement de l'hôte doit également pouvoir affecter la dynamique de transmission du pathogène ou du parasite, ce qui exclut certains parasites, mais aussi certains pathogènes très virulents. Il est facile d'imaginer comment la transmission des helminthes et autres peut être affectée par les comportements de l'hôte, mais pour les insectes piqueurs qui ne font que recueillir un repas de sang et ne pondent pas leurs œufs dans ou sur un hôte, les comportements de l'hôte n'influenceront pas leur transmission.

Considéré comme un exemple, le suicide adaptatif ne devrait donc pas se développer chez l'homme en réponse à des parasites comme les glossines car ils ne sont pas assez virulents. Elle ne se développerait pas non plus en réponse aux protozoaires qui utilisent la mouche tsé-tsé comme vecteur et causent la maladie du sommeil [76]. Même si la maladie du sommeil est très virulente, tuant pratiquement toute personne non traitée, l'agent pathogène ne se propage que lorsqu'un autre insecte piqueur prend un repas de sang de la personne infectée [76]. Une personne infectée pouvait se suicider dès qu'elle réalisait qu'elle était infectée, réduisant ainsi son attrait pour d'autres glossines à mesure que son corps se refroidissait. Cependant, il n'est pas évident que cette réduction de la prévalence de l'agent pathogène profiterait à la parenté de manière significative, car le cycle de vie de l'agent pathogène chez la mouche prend trois semaines (de l'alimentation sur une personne à la possibilité de se propager à une autre), au cours desquelles fois que la mouche tsé-tsé aura parcouru une longue distance, il est peu probable que la mouche tsé-tsé transmette l'agent pathogène de vous à votre parenté.

D'un autre côté, on peut s'attendre à ce que d'autres taxons développent des tendances suicidaires chez l'hôte lorsqu'ils sont infectés par des agents pathogènes et des infections particuliers, ainsi que par certains parasites. Nous avons déjà évoqué des cas antérieurs où des fourmis infectées par une maladie fongique s'isolent de leurs colonies [42], mais alors que les champignons entomopathogènes peuvent subir une transmission accrue à partir de la dispersion de leur hôte [41,77], cette manipulation comportementale par la maladie peut être un co -option de suicide adaptatif de l'hôte. Alors que les comportements d'hygiène du nid chez les fourmis, par ex. l'élimination des individus infectés ou la séquestration des individus dans le nid avant qu'ils n'atteignent le stade infectieux - sont généralement une stratégie d'amélioration de la condition physique plus efficace face aux infections, le suicide adaptatif pourrait évoluer lorsque les taux d'infection sont rapides et si étendus que la réponse hygiénique est dépassé [78,79].

6. Conclusions et suggestions pour de futures recherches

Il y a un manque de consensus sur le suicide adaptatif. D'une part, le comportement semble théoriquement très plausible en tant qu'adaptation d'hôte très efficace étant donné un état parasité extrêmement nocif et le sort d'opportunités de fitness directes considérablement réduites. D'un autre côté, les travaux empiriques ont jusqu'à présent fait l'objet de nombreuses critiques, et il s'est avéré difficile de définir définitivement l'adaptation de l'hôte en dehors des explications alternatives. Les meilleures preuves, théoriques et empiriques, pour la sélection du suicide adaptatif chez les individus infectés proviennent d'études sur les bactéries et les systèmes Abi.

Une approche utile pour les recherches futures - soulignée par Müller & amp Schmid-Hempel [39] en ce qui concerne les bourdons parasités mais vrai de toute étude sur les altérations du comportement lors d'une invasion parasitaire - serait des mesures détaillées des coûts et des avantages à la fois pour l'hôte et son parasitoïde. à analyser avec soin, ainsi que toute influence que le stress physiologique peut avoir. L'inclusion d'un examen de la dynamique plus large de la population et du contexte écologique peut être un élément important pour évaluer les avantages nets pour l'hôte et le parasitoïde. Élucider les mécanismes immédiats qui sous-tendent les altérations du phénotype de l'hôte [80], dans la mesure du possible, serait également utile lorsqu'ils pourraient aider à identifier la manipulation du parasite, voire l'exclure en faveur de l'adaptation ou de la pathologie de l'hôte. Davantage d'études comportementales sur les comportements généralement autodestructeurs chez les insectes sociaux, y compris des analyses coûts-avantages et des études mécanistiques, sont également nécessaires [73] et des comparaisons entre les changements de comportement liés à la maladie, à l'état et aux parasites peuvent alors faire la lumière sur le potentiel de suicide adaptatif lors d'une infection par rapport à d'autres explications.

En ce qui concerne les espèces non eusociales qui ont tendance à se regrouper avec des compagnons clones, Durán Prieto et al. [28] proposent une explication convaincante de la façon dont les comportements suicidaires peuvent conduire à une prédation accrue des pucerons parasités. D'autres études devraient chercher à déterminer si les taux de prédation sur les parents non parasités diminuent grâce aux pucerons parasités augmentant considérablement leur propre risque personnel de prédation en adoptant des comportements particuliers. Il serait très intéressant de savoir si d'autres études pourraient prouver que, à un stade précoce du parasitisme, une plus grande sensibilité des pucerons parasités à la prédation est un phénomène courant [28].

Dans une perspective différente, il serait intéressant d'explorer s'il existe des systèmes hôte-parasite qui conduisent un individu infecté à diminuer sa propre fécondité afin d'empêcher les parasites de produire des unités infectieuses qui pourraient ensuite infecter ses proches. Cela serait peut-être considéré comme un « suicide reproductif » adaptatif, dans lequel toute reproduction future et toute forme physique directe sont coupées, mais peut-être qu'un individu qui pourrait continuer à aider ses proches sans les infecter ainsi n'a pas besoin de se débarrasser entièrement de lui-même. La réduction de la fécondité de l'hôte suite à une invasion parasitaire a déjà été suggérée comme stratégie adaptative pour limiter les dommages dans certains cas [81]. Hurd [82] décrit comment la réduction de la fécondité des hôtes femelles dans l'association entre les métacestodes du ténia du rat (Hyménolepis diminuta) et un coléoptère hôte intermédiaire (Tenebrio molitor) peut bénéficier à la fois au parasite et à l'hôte. Ici, le taux de production d'œufs de l'hôte est plus lent lors de l'infection, mais cela est compensé par une durée de vie plus longue qui pourrait finalement permettre à la fécondité à vie d'égaler ou de dépasser celle des femelles non infectées. Le parasite peut également y gagner si une durée de vie plus longue augmente la probabilité que le coléoptère soit prédaté, augmentant ainsi la transmission du parasite [82]. Au-delà d'une fécondité de l'hôte simplement réduite, s'il existe des cas où un hôte met fin à sa fécondité plutôt que d'augmenter sa mortalité, un arrêt de l'effort de reproduction pourrait représenter une adaptation entièrement bénéfique pour l'hôte qui pourrait agir pour protéger sa famille contre les unités infectieuses multipliées. Toute exploration d'un tel « suicide reproductif » pourrait donner une perspective supplémentaire sur les adaptations extrêmes choisies par les parents face au parasitisme.

Les travaux de modélisation explorant la relation précise entre les coûts et les avantages impliqués dans le suicide adaptatif chez les insectes sociaux pourraient également être d'une grande utilité pour essayer de comprendre dans quelles situations l'évolution des comportements suicidaires en tant qu'adaptation de l'hôte pourrait être plus plausible que la manipulation et/ou la pathologie du parasite. . Dans le cas des bactéries, des travaux futurs développant une compréhension de la façon dont le suicide altruiste peut l'emporter sur des défenses plus simples qui empêchent l'infection en premier lieu seraient extrêmement précieux [74]. De plus amples détails sur la nature des signaux de commutation dans le couplage immunité-suicide chez les bactéries, les valeurs seuils pertinentes et leurs déterminants sont autant de pistes intéressantes ouvertes pour de futures études [57]. Les effets à plus long terme du suicide adaptatif chez les bactéries sur la complexité [83] et l'évolution des populations microbiennes seront également intéressants à explorer davantage. L'élargissement du cadre théorique pour inclure la prise de conscience de la structuration spatiale et de la diversité des cycles de vie des hôtes et des parasites permettrait la production de modèles plus informatifs, et d'autres études empiriques pour valider les prédictions théoriques concernant la sélection sous différentes structures spatiales pourraient également être extrêmement utiles [74] . Les implications coévolutives du suicide adaptatif par des bactéries pour éviter une infection à l'échelle de la population dans des environnements structurés spatialement restent mûres pour des tests empiriques [84]. Une plus grande considération à travers les taxons de l'endroit où certains comportements pourraient potentiellement bénéficier à la fois à l'hôte et à son parasite - et l'exploration de l'endroit où cela peut également s'appliquer aux cas d'infection par des agents pathogènes - pourrait également donner des résultats intéressants.


Matériaux et méthodes

Insectes

S. littoralis les larves ont été élevées sous régime artificiel (47,3 g/l de germe de blé, 67,3 g/l de levure de bière, 189 g/l de semoule de maïs, 6,8 g/l d'acide ascorbique, 0,75 g/l de cholestérol, 0,5 g/l de 4-hydroxybenzoate de propyle, 3 g/l de 4-hydroxybenzoate de méthyle, 1,3 g/l d'huile de germe de blé, 33,8 g/l d'agar et 3 g/l de mélange de vitamines (1,2 g/Kg de vitamine B1, 2,6 g/Kg de vitamine B2, 2,5 g/Kg de vitamine B6 , 40 g/Kg de choline, 10 g/Kg d'acide pantothénique, 32 g/Kg d'inositol, 0,25 g/Kg de biotine, 2,5 g/Kg d'acide folique, 5 g/Kg d'acide 4-aminobenzoïque, 0,5 mg/Kg de vitamine B12, 10 g/Kg de glutathion, 2,1 g/Kg de vitamine A, 0,25 g/Kg de vitamine D3, 24 g/Kg de vitamine E, 0,25 g/Kg de vitamine K, 25 g/Kg de vitamine C dans le dextrose)), à 25 ± 1°C , 70 ± 5 % HR, et sous une période lumière/obscurité de 16:8 h.

Prélèvement d'échantillons de tissus et extraction d'ARN/ADN

S. littoralis les larves ont été anesthésiées sur de la glace et stérilisées en surface avec de l'éthanol à 70 % avant la dissection. L'hémolymphe larvaire a été prélevée sur une coupe de jambe et les hémocytes ont été séparés du plasma par centrifugation pendant 5 min, à 500 × g, à 4°C. L'intestin moyen et le corps adipeux ont été isolés après avoir coupé le corps larvaire dans le sens de la longueur, et la carcasse restante a été collectée séparément. Ces échantillons (c. L'ADN a été extrait des hémocytes en utilisant le protocole décrit ailleurs [59], avec des modifications mineures. La concentration d'ARN ou d'ADN extrait a été évaluée en mesurant l'absorbance à 260 nm, avec un lecteur Varioskan Flash Multimode (Thermo Scientific, Waltham, MA, USA), et la pureté de l'échantillon a été évaluée en évaluant le rapport d'absorbance de 260/280 nm. La qualité de l'ARN a été vérifiée par électrophorèse sur gel d'agarose 1%.

Sl gasmin clonage et analyse bioinformatique

Un partiel Sl gasmin L'ADNc (FQ973054.1) a été identifié par analyse BLAST [60, 61] dans une base de données publique d'étiquettes de séquences exprimées (EST) de S. littoralis antenne femelle, en utilisant comme requête la séquence d'ADNc pleine longueur de S. exigua gasmin (KP406767.1).

Isoler Sl gasmin ORF, ARN total extrait d'hémocytes de S. littoralis Les larves de 6 ème stade ont été soumises à une rétro-transcription (kit Ambion RETROscript ® - Life Technologies). Étant donné le niveau très élevé d'identité de séquence à gasmin (Fig 1), un ADNc a été obtenu par PCR, en utilisant Phusion High-Fidelity DNA Polymerase (Fisher Scientific, Pittsburgh, PA, USA) et des amorces conçues pour amplifier l'ensemble gasmin ORF (gasmin Amorce directe ORF ATGTTGCCTATTACCATACTAACG, gasmin Amorce inverse ORF ATACTGGAATTGGACATATTTGAGC). Les conditions de PCR ont été programmées pendant 30 s à 98°C 40 cycles de [10 s 98°C, 30 s 60°C, 1 min 72°C] et 15 min à 72°C. Après amplification, le produit PCR obtenu a été séparé par électrophorèse sur gel et la bande visible de la taille attendue a été purifiée avec un kit COMBO Quick gel extraction & PCR purification (Invitrogen, Carlsbad, CA, USA). Le produit PCR a été cloné dans le vecteur Zero-Blunt TOPO (Zero-Blunt TOPO PCR Cloning Kit, Invitrogen), selon les instructions du fabricant. Après transformation de One Shot TOP10 chimiquement compétent E. coli (Invitrogen), les transformants ont été incubés pendant une nuit à 37°C sur des plaques LB contenant 50 ug/ml de kanamycine. Les colonies bactériennes contenant le fragment de la taille appropriée ont été sélectionnées par PCR de colonie, en utilisant l'ADN polymérase haute fidélité Phusion (Fisher Scientific) et les amorces inverses M13 Forward (-20)/M13 (Invitrogen), et cultivées pendant une nuit dans un milieu LB contenant 50 g /ml de kanamycine. L'ADN plasmidique a été extrait de 4 ml de culture bactérienne en utilisant un kit de miniprep plasmide Charge Switch-Pro (Invitrogen), comme indiqué par le fabricant et séquencé.

La présence d'un intron dans Sl gasmin a été déterminée par amplification PCR de l'ADN total extrait de S. littoralis hémocytes utilisant Phusion High-Fidelity DNA Polymerase (Thermo Fischer Scientific) avec des amorces spécifiques (gasmin Amorce directe ORF ATGTTGCCTATTACCATACTAACG gasmin amorce inverse d'intron CAGGTGTCCGCATTCCACTGA). La longueur des produits PCR a été contrôlée par électrophorèse sur gels d'agarose 1%, avant séquençage.

Recherches de similarité approfondies dans des bases de données de séquences génomiques complètes et à haut débit hébergées par le NCBI à l'aide de TBLASTN, ainsi que dans des bases de données de protéines non redondantes (BLASTP), en utilisant la méthode inférée S. exigua et S. littoralis séquences protéiques, a permis l'identification de nombreux homologues potentiels. Celles-ci ont été annotées manuellement pour identifier les régions codantes et introniques probables. Les alignements préliminaires des séquences d'acides aminés inférées (351 aa) ont été effectués à l'aide de Muscle [62] et filtrés manuellement pour identifier les homologues, qui pourraient être alignés essentiellement de manière contiguë avec le Spodoptera séquences protéiques. Les alignements ont été affinés manuellement et les régions alignées de manière ambiguë ont été exclues à l'aide du programme GBlocks [63], laissant XX positions d'acides aminés pour la reconstruction phylogénétique à l'aide de PhyML [64] comme implémenté dans le programme SEAVIEW [65], sous la matrice de substitution d'acides aminés JTT, avec 4 catégories de taux de substitution distribuées gamma (voir fichier S2). Les proportions de bootstrap ont été estimées à l'aide de paramètres optimisés sur l'arbre ML original (paramètre de distribution de taux (alpha) = 1,45).

Pour identifier les signatures de sélection, la méthode FEL (Fixed Effects Likelihood) a été utilisée [66], implémentée sur le site Web de DataMonkey (http://datamonkey.org/) [67]. Séquences nucléotidiques de S. exigua, S. littoralis et C. congrégation le cercle de virus 25, y compris l'intron, ont été alignés et l'alignement a été organisé manuellement pour maintenir l'alignement des codons dans le cadre. La sélection a été testée dans le S. exiguaS. littoralis branches.

Sl gasmin analyse d'expression par qRT-PCR

L'ARN total utilisé pour l'analyse transcriptionnelle a été isolé comme décrit ci-dessus. L'expression relative des gènes étudiés a été mesurée par qRT-PCR en une étape, en utilisant le kit SYBR Green PCR (Applied Biosystems, Carlsbad, CA, USA), selon les instructions du fabricant. S. littoralis β-actine (Z46873) a été utilisé comme contrôle endogène pour la charge d'ARN. Le logiciel Primer Express 1.0 (Applied Biosystems) a été utilisé pour concevoir les amorces utilisées (tableau S3). Les données d'expression relative des gènes ont été analysées à l'aide de la méthode ΔΔCt [68–70]. qRT-PCR pour la mesure de Sl gasmin l'expression a été réalisée à l'aide d'amorces spécifiques (tableau S3), conçues pour détecter une région de Sl gasmin ARNm non inclus dans la séquence ciblée par l'ARNdb (voir paragraphe « synthèse d'ARNdb »). Pour la validation de la méthode ΔΔCt, la différence entre la valeur Ct de Sl gasmin et la valeur Ct de -actine transcrits [ΔCt = Ct (Sl gasmin)-Ct (-actine)] a été tracé en fonction du log des dilutions en série de dix fois (2000, 200, 20, 2 et 0,2 ng) des échantillons d'ARN purifiés. Le tracé du log de l'entrée d'ARN total en fonction de ΔCt affichait une pente inférieure à 0,1 (Y = 1,149 + 0,0133X, R 2 = 0,0493), indiquant que les efficacités des deux amplicons étaient approximativement égales.

Profils d'expression de Sl gasmin en réponse à différents agents pathogènes

Analyser Sl gasmin expression en réponse à un défi microbien, S. littoralis Les larves du 5 e stade, stérilisées en surface avec de l'éthanol à 70 % et réfrigérées sur de la glace, ont reçu une injection intra-hémocélique de 2 × 10 7 E. coli, 3 × 10 8 S. aureus ou 2 × 10 7 S. cerevisiae cellules, en suspension dans 5 µl de PBS (Phosphate Buffered Saline : 137 mM NaCl, 2,7 mM KCl, 10 mM tampon phosphate, pH 7,4). Les injections ont été réalisées à travers la membrane du col, en utilisant une seringue Hamilton Microliter 1701RN (10 µl, jauge 26s, longueur 51 mm, aiguille 3). A l'injection et à différents moments après l'injection, les larves expérimentales (n = 12 pour chaque traitement expérimental) ont été disséquées et les hémocytes ont été collectés et traités pour l'extraction de l'ARN total comme décrit ci-dessus l'expression relative de Sl gasmin a été évalué par qRT-PCR.

Synthèse d'ARNdb

ARN total extrait des hémocytes de S. littoralis Les larves de 6 e stade ont été rétro-transcrites (kit Ambion RETROscript, Life Technologies) et une longueur de 789 pb Sl gasmin Le fragment d'ADNc a été obtenu par PCR, en utilisant le Sl gasmin amorce directe d'ARNdb (GCCCGGCATGTGTTCTATTACC) en combinaison avec le Sl gasmin Amorce inverse d'ARNdb (TCCTTCCAGCTTCTGAGTCA). Ce fragment d'ADNc a été utilisé comme matrice pour une réaction de nested-PCR, réalisée avec des amorces contenant à leurs extrémités 5' la séquence du promoteur de la polymérase T7 (T7-Sl gasmin avant TAATACGACTCACTATAGGGAG-TTCGAGGATACAAGCAGAG T7-Sl gasmin inverse TAATACGACTCACTATAGGGAG-GGATGCTCAGGATATCTGTTAC). Le produit PCR résultant a été utilisé comme modèle pour synthétiser Sl gasmin dsRNA (522 pb de long), en utilisant le kit Ambion MEGAscript RNAi (Life Technologies), selon les instructions du fabricant. L'ARNdb de contrôle, long de 500 pb, a été obtenu à partir d'une matrice de contrôle fournie par le kit utilisé. Les préparations d'ARNdb ont été quantifiées en mesurant leur absorbance à 260 nm avec un lecteur multimode Varioskan Flash, et la pureté a été évaluée en évaluant les rapports d'absorbance de 260/280 nm. Les produits ont été analysés sur des gels d'agarose à 1 % pour confirmer leur intégrité.

Administration d'ARNdb à S. littoralis les larves et le silence de Sl gasmin

S. littoralis Les larves de 4 ème stade (1 er jour) ont été anesthésiées sur de la glace et 1 l de Sl gasmin L'ARNdb ou ARNdb témoin (voir ci-dessus), dissous dans du PBS, a été versé dans la lumière de l'intestin antérieur au moyen d'une seringue Hamilton Microliter 1701RN (10 l, jauge 26s, longueur 51 mm, aiguille 2). Les traitements d'ARNdb consistaient en une administration orale de 150 ng par jour, pendant 3 jours (du 4ème au 5ème stade larvaire). Après la dernière administration d'ARNdb et avant toute expérience, les hémocytes de 3 à 4 larves traitées ont été utilisés pour l'analyse qRT-PCR, afin de confirmer l'occurrence du silençage génique.

Test biologique Cry1Ca et évaluation de la charge bactérienne

La protéine Cry1Ca purifiée a été produite dans un B. thuringiensis souche EG1081 (Ecogen Inc.). Avant utilisation, Cry1Ca a été dialysé pendant une nuit, à 4°C dans un tampon de carbonate de sodium 50 mM, pH 9,0. Après dialyse, la concentration en toxine a été déterminée par le test de Bradford [71], en utilisant comme standard de l'albumine de sérum bovin.

Les larves silencieuses et témoins ont été isolées individuellement dans des plateaux en plastique à puits multiples (Bio-Ba-32, Color-Dec, Italie), contenant un régime artificiel, recouverts de couvercles en plastique perforés (Bio-Cv-4, Color-Dec), et maintenus dans les conditions d'élevage décrites ci-dessus. Pendant les 3 premiers jours, la surface supérieure (1 cm 2 ) du régime artificiel (0,3 cm 3 ) a été uniformément recouverte de 50 µl de toxine Cry1Ca purifiée, dissoute dans du tampon carbonate de sodium 50 mM à pH 9,0. Les larves témoins ont été élevées sur un régime artificiel recouvert de 50 µl de tampon de carbonate de sodium. Les larves expérimentales ont été maintenues sous régime artificiel, remplacées toutes les 24 h et inspectées quotidiennement pour leur survie, jusqu'à la nymphose. Pour déterminer la concentration létale à 50 % (CL50) de la toxine Cry1Ca, l'essai biologique a été réalisé à 5 concentrations différentes de toxine et en utilisant 16 larves pour chaque condition expérimentale et témoin. Analyse probit [72], pour déterminer la CL50 les valeurs au jour 10, les limites de référence à 90 % et le rapport d'augmentation de la toxicité (TI) pour chaque traitement expérimental, a été réalisée avec le programme POLO-PC (LeOra Software, Berkeley, CA).

L'évaluation des charges bactériennes a été réalisée comme décrit précédemment [32]. Brièvement, 6 h après le dernier Sl gasmin ou GFP Administration d'ARNdb, nouvellement mué 5e larves au stade larvaire de S. littoralis, ont été exposés pendant 3 jours à 2,7 g/cm 2 (correspondant à la CL50 de Cry1Ca dans Sl gasmin larves réduites au silence). Les deux groupes expérimentaux comprenaient des contrôles internes maintenus sur un régime sans toxine. Au jour 7, les larves ont été transférées dans un régime non traité et, 24 h plus tard, l'intestin moyen et l'hémolymphe ont été collectés séparément sous une hotte à flux laminaire horizontale comme décrit ci-dessus. Des échantillons expérimentaux ont été obtenus en rassemblant 10 larves. L'expérience a été répétée 3 fois. Les changements dans le temps de la charge bactérienne relative dans l'intestin moyen (n = 7 pour chaque point d'échantillonnage) et les échantillons d'hémolymphe (n = 8 pour chaque point d'échantillonnage) ont été déterminés par qRT-PCR, mesurant le niveau de transcrit de ARNr 16S (AJ567606.1) pour évaluer l'impact de Bt toxine et Sl gasmin silence sur la prolifération bactérienne. La qRT-PCR a été réalisée comme décrit ci-dessus, en utilisant S. littoralis β-actine comme gène rapporteur (les amorces utilisées sont rapportées dans le tableau S3).

Tests immunitaires cellulaires et humoraux

L'impact du silençage génique sur les réponses immunitaires cellulaires a été évalué en notant son effet sur l'encapsulation, la nodulation et la phagocytose. Les réponses d'encapsulation et de nodulation ont été évaluées comme décrit précédemment [31, 32]. Des billes de chromatographie à flux rapide CM Sepharose (Pharmacia), en suspension dans du PBS, ont été injectées dans l'hémocèle de S. littoralis larves à l'aide d'une seringue Hamilton Microliter 1702 RN (25 l, jauge 22s, longueur 55 mm, aiguille 3). Après 24 h, les billes ont été récupérées lors de la dissection larvaire et notées pour évaluer leur taux d'encapsulation, qui a été exprimé avec l'indice d'encapsulation (EI = [Σ (degré d'encapsulation × billes totales de ce degré)/ billes totales × 4] × 100), qui prend en compte à la fois le degré d'encapsulation de chaque bille récupérée (0—pas de cellules adhérentes aux billes, 1—jusqu'à 10 cellules adhérentes, 2—plus de 10 cellules adhérentes mais pas de couche complète autour de la bille, 3-une ou plus couches complètes sans mélanisation, 4 - une ou plusieurs couches complètes avec mélanisation) et l'abondance relative des billes avec un degré d'encapsulation donné [73]. Pour le test de nodulation, 12 h après la dernière administration d'ARNdb, S. littoralis les larves, stérilisées en surface à l'éthanol à 70% et refroidies sur glace, ont reçu une injection intra-hémocélique de 5 l d'une suspension PBS de 2 × 10 6 E. coli cellules, ou 2 × 10 7 S. cerevisiae cellules. Les injections ont été effectuées à travers la membrane du cou, en utilisant un Hamilton 1701 RN SYR (10 ul, jauge 26s, 55 mm de long, pointe style 3). Une jambe thoracique a été coupée 18 h après l'injection, et l'hémolymphe exsudative a été recueillie et immédiatement diluée dans un volume égal de tampon anticoagulant MEAD glacé (98 mM de NaOH, 145 mM de NaCl, 17 mM d'EDTA et 41 mM d'acide citrique, pH 4.5). Les nodules hémocytaires apparaissant dans les échantillons d'hémolymphe ont été comptés sous un microscope à transmission lumineuse à un grossissement de 400x (Axioskop 20, Carl Zeiss Microscopy, Allemagne), en utilisant une chambre Bürker. Lorsqu'une réponse immunitaire intense donnait lieu à de grands agrégats de nodules difficiles à dénombrer séparément, le nombre de nodules distincts observés était arbitrairement doublé, car le pourcentage de pixels non blancs mesurés (logiciel ZEN Carl Zeiss Microscopy) sur les grands agrégats était en moyenne deux fois supérieur à mesurée sur un champ de microscopie lumineuse contenant des nodules discrets et des hémocytes libres.

Pour mesurer la compétence de phagocytose de S. littoralis hémocytes, un in vitro Le dosage a été réalisé comme décrit dans [32] avec des modifications mineures. En bref, des échantillons d'hémolymphe ont été prélevés sur une coupe de jambe dans du PBS glacé (1:1 v/v) et ajoutés avec un volume égal d'une suspension de PBS de 2 × 10 6 fluorescéine conjuguée E. coli (souche K-12 BioParticles, conjugué fluorescéine, Invitrogen) ou 2 × 10 7 S. aureus (Souche Wood, Conjugué de fluorescéine BioParticles, Invitrogen). Après incubation avec E. coli (10 min) ou avec S. aureus (30 min), les échantillons ont été chargés dans une chambre Bürker, où les hémocytes totaux et fluorescents ont été comptés sous un microscope à fluorescence (Axioskop 20). Avant de commencer les expériences d'incubation, une coloration vitale au bleu trypan a été utilisée pour vérifier de manière routinière la viabilité des hémocytes collectés. Une aliquote d'hémolymphe a été mélangée avec 0,4 % (p/v) de bleu trypan (2:1 v/v), avant de compter les cellules viables et mortes au microscope à transmission lumineuse (Axioskop 20), en utilisant une chambre Bürker. Les échantillons d'hémocytes avec un taux de viabilité inférieur à 98% ont été rejetés.

Pour les expériences de sauvetage avec des hémocytes de larves silencieuses, des échantillons d'hémolymphe ont été extraits de S. littoralis larves réfrigérées sur glace, 24 h après la dernière administration d'ARNdb (Sl gasmin ARNdb ou ARNdb de contrôle). Les échantillons ont été centrifugés 5 min à 500 × g, à 4°C. Le plasma a été conservé sur de la glace, les hémocytes ont été remis en suspension dans du PBS et centrifugés comme décrit précédemment. Le PBS a ensuite été retiré et les hémocytes des larves ont été traités avec Sl gasmin Les ARNdb ont été remis en suspension dans le plasma isolé des larves traitées avec l'ARNdb témoin, tandis que les hémocytes des larves traitées avec l'ARNdb témoin ont été remis en suspension dans le plasma isolé des larves traitées avec Sl gasmin ARNdb. Ensuite, la phagocytose par les hémocytes a été évaluée comme décrit ci-dessus.

La réponse immunitaire humorale, telle qu'affectée par le silençage génique, a été évaluée en mesurant le niveau de transcrit des gènes codant pour les peptides antimicrobiens et le lysozyme, en réponse à des injections de différents micro-organismes, comme décrit précédemment [32]. Brièvement, 6 h après la dernière administration d'ARNdb, S. littoralis les larves, stérilisées en surface avec de l'éthanol à 70 % et réfrigérées sur glace, ont reçu une injection intra-hémocélique de 2 × 10 7 E. coli ou S. aureus cellules, ou 3 × 10 8 S. cerevisiae cellules, en suspension dans 5 l de PBS. Les injections ont été réalisées à travers la membrane du col avec un Hamilton 1701 RN SYR (10 µl, jauge 26s, longueur 55 mm, aiguille 3). Au moment de l'injection et 18 h après l'injection, les larves (n = 8 pour chaque échantillon expérimental) ont été disséquées et les hémocytes, l'intestin moyen et le corps adipeux ont été collectés et traités pour l'extraction de l'ARN total, comme décrit ci-dessus. L'expression relative de attacine 1 (FQ971100.1), ganterie (FQ965511.1), et lysozyme 1a (FQ961692.1) ont ainsi été évalués par q-RT-PCR comme décrit ci-dessus. Les amorces utilisées sont indiquées dans le tableau S3.

Détection de filaments d'actine dans les hémocytes

Larves nouvellement muées du 5 e stade de S. littoralis, traité avec Sl gasmin L'ARNdb ou l'ARNdb témoin, comme décrit ci-dessus, ont été stérilisés en surface avec de l'éthanol à 70 % et refroidis sur de la glace. L'hémolymphe larvaire de larves individuelles a été collectée à partir d'une coupe de la jambe et placée sur des lames de verre pendant 10 min, pour permettre aux hémocytes de se déposer et de se fixer au verre. L'hémolymphe a ensuite été soigneusement prélevée et les hémocytes rincés 3 fois avec du PBS. Les cellules attachées ont été fixées pendant 10 min dans du paraformaldéhyde à 4 % dans du PBS, lavées 3 fois dans du PBS et perméabilisées pendant 4 min avec 0,1 % de Triton-X100 dans du PBS. Les hémocytes ont été lavés 3 fois dans du PBS puis incubés pendant 20 min avec 4 µg/ml de TRITC-phalloidine (Tetramethylrhodamine B isothiocyanate-phalloidine). Après 3 rinçages en PBS, les échantillons ont été montés en Vectashield Mounting Medium avec DAPI (Vector Laboratories) et examinés au microscope à fluorescence (ZEISS Axiophot 2 epifluorescence microscope). Les observations ont été réalisées dans 3 expériences différentes et en considérant au moins 10 champs microscopiques choisis au hasard pour chaque condition expérimentale.

Approche protéomique ciblée par surveillance de réactions multiples (MRM)

Pour détecter la présence de SL gasmin dans le plasma, l'hémolymphe a été centrifugée comme décrit ci-dessus pour éliminer les hémocytes, et le surnageant (plasma) a été stocké à -80°C. Les échantillons ont ensuite été dissous dans un tampon dénaturant (urée 6 M, EDTA 10 mM, Tris 300 mM, pH 8,0) contenant du dithiothréitol (excès molaire 10 fois sur les résidus Cys) à 37 °C pendant 2 h, avant l'ajout d'iodoacétamide ( IAM) pour effectuer la carboamidométhylation, en utilisant un excès molaire 5 fois d'agent d'alkylation sur les résidus thiol. Le mélange a été incubé dans l'obscurité à température ambiante pendant 30 minutes et le produit a été purifié par Chloroforme/Méthanol/H2précipitation. Les surnageants ont été éliminés et les culots ont été séchés. La digestion du mélange de protéines a été effectuée dans du bicarbonate d'ammonium 10 mM (AMBIC), en utilisant de la trypsine à un rapport de masse protéine/enzyme de 50:1. Les échantillons ont été incubés à 37°C pendant 16 h et séchés après acidification (10 % de HCOOH dans l'eau). Pour éliminer toute impureté, les échantillons ont été mis en suspension dans 200 µl d'AMBIC 100 mM, filtrés par des unités de filtration centrifuge (0,22 µm) et séchés dans un concentrateur speed-vac. Les échantillons ont été évaporés et mis en suspension dans 50 µl de HCOOH à 0,1% dans l'eau. Les mélanges de peptides ont été analysés par analyse LC-MRM/MS en utilisant un Xevo TQ-S (Waters, Milford, MA, USA) avec une source IonKey UPLC Microflow couplée à un système UPLC Acquity (Waters), en utilisant un dispositif IonKey. Pour chaque essai, 1 l de mélange de peptides a été séparé sur une colonne RP analytique TS3 1,0 mm × 150 mm (Eaux) à 60 °C, avec un débit de 3 l/min en utilisant 0,1 % de HCOOH dans de l'eau (qualité LC-MS) comme éluant A, et 0,1 % HCOOH dans l'acétonitrile comme éluant B. Les peptides ont été élués (en commençant 1 min après injection) avec un gradient linéaire d'éluant B dans A, de 7 % à 95 % en 55 min. La colonne a été rééquilibrée aux conditions initiales pendant 4 min. Les analyses de spectrométrie de masse MRM ont été effectuées en mode ion positif en utilisant une fenêtre de détection MRM de 0,5 à 1,6 min par peptide, le cycle de service a été réglé sur automatique et les temps de séjour étaient au minimum de 5 ms. La tension du cône a été réglée à 35V. Les transitions sélectionnées et l'énergie de collision pour chaque SL peptide gasmin sont rapportés dans le tableau S2.

Pour déterminer si SL gasmin est capable de se lier à la surface des bactéries, des échantillons de plasma obtenus à partir S. littoralis Les larves du 5 e stade (n = 20) ont été ajoutées à un volume égal de MEAD et incubées avec un volume égal de E. coli suspension dans du PBS (4 × 10 6 cellules pour chaque l d'hémolymphe) pendant 1 h. La suspension a ensuite été centrifugée pendant 10 min, à 12 000 x g, à 4°C et le culot a été remis en suspension dans 2 ml de tampon phosphate 10 mM, 45 mM NaCl, pH 7,4. La centrifugation et la remise en suspension ont été répétées et le culot bactérien ainsi que les surnageants ont été congelés dans de l'azote liquide et stockés à -80°C jusqu'à utilisation. Dans les expériences témoins, les bactéries ont été incubées avec du PBS et du MEAD (1:1:1 v/v/v). Les échantillons ont été soumis à une réduction, une alkylation et une digestion trypsique comme décrit ci-dessus. Après l'étape de préparation, ils ont été traités et analysés par LC-MRM/MS, comme décrit précédemment. Les analyses LC-MRM/MS ont été effectuées sur 3 réplicats techniques pour chaque réplicat biologique et la moyenne de ces multiples mesures a été utilisée pour l'analyse des données. Les données obtenues représentent la valeur moyenne du courant ionique total associé à chaque transition pour les peptides sélectionnés.

Réactifs

Sauf indication contraire, tous les réactifs ont été fournis par Sigma-Aldrich, Italie.

Analyses statistiques

Les données ont été analysées à l'aide des logiciels Prism (GraphPad Software Inc. version 6.0b, San Diego, CA, USA) et SPSS (IBM SPSS Statistics, Version 21, Armonk, NY). La comparaison entre 2 groupes expérimentaux a été effectuée en utilisant le test de Student non apparié. t test, tandis que dans le cas de plus de 2 groupes expérimentaux, One-Way ANOVA. Une ANOVA bidirectionnelle a été réalisée sur AMP et lysozyme 1A expériences d'induction immunitaire, avec traitement ARNi et injection bactérienne comme facteurs, tandis qu'une ANOVA à trois voies a été réalisée pour la quantification relative des bactéries, avec traitement ARNdb, temps et exposition à la toxine Cry1Ca comme facteurs. Lorsque la transformation nécessaire des données a été effectuée, pour répondre à l'hypothèse de normalité. Le test de Levene a été réalisé pour tester l'homogénéité de la variance. Lorsque des effets significatifs ont été observés (P value<0.05), le test post-hoc de Bonferroni a été utilisé. Lorsque l'une des hypothèses n'était pas satisfaite, même après la transformation des données, le test ANOVA unidirectionnel de Kruskal-Wallis (ANOVA non paramétrique) était utilisé.


Superpouvoir de la rougeole : une contagiosité extrême

En plus de paralyser votre système immunitaire, l'infectiosité du virus de la rougeole est légendaire : jusqu'à 9 personnes sensibles sur 10 développeront la rougeole si elles entrent en contact avec une personne infectée.

La toux et les éternuements envoient le virus de la rougeole hors de votre corps et dans les airs. Image adaptée de : James Gathany / CDC CC0

Une toux induite par la rougeole peut facilement et efficacement projeter de nombreuses particules virales dans l'air, où elles peuvent rester longtemps sur les surfaces (jusqu'à deux heures, dans certains cas). Cela peut être particulièrement dangereux dans les toilettes d'avion, les salles d'attente des médecins ou d'autres endroits où de nombreuses personnes partagent un petit espace aérien.


Voir la vidéo: Hypnose et système immunitaire version longue (Janvier 2022).