Informations

Aider à expliquer les allèles multiples en termes de code génétique réel

Aider à expliquer les allèles multiples en termes de code génétique réel


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Je comprends que la constitution génétique d'une personne au niveau d'un allèle est généralement désignée par (AA,Aa,aa).

Cela signifie qu'au lieu d'une paire A-T, vous obtenez une paire C-G sur aucune, 1 ou 2 copies.

Maintenant, que se passe-t-il exactement lorsque vous avez un tri-allèle (comme dans le groupe sanguin). Envisagent-ils deux positions de base? Ou est-ce qu'au lieu d'une mutation A -> C, vous obtenez quelque chose de plus étrange comme une mutation A -> G (et donc vous devez tenir compte de la directionnalité), etc.

Merci!


Toutes ces choses se produisent, mais les SNP trialléliques (polymorphismes nucléotidiques simples) se réfèrent au cas où une seule base spécifique dans le génome peut avoir l'une des trois bases. Ex. : A/G/C

Cas où plus d'une base dans une séquence change. Cela n'a pas vraiment de nom cependant : (par exemple AA -> GC ).

Ceux-ci peuvent être appelés allèles a/b/c, je suppose.

La raison pour laquelle cela n'a pas de nom est probablement parce que deux bases ne changent pas vraiment en même temps qu'un événement commun. Si deux SNP sont côte à côte, ils ont probablement changé à des moments différents, ce qui signifie que si vous regardez suffisamment autour de vous, vous trouverez AA, GC et GA car le A->G s'est produit en premier, puis quelques dizaines de générations le second A- > La mutation C s'est produite.


Je comprends que la constitution génétique d'une personne à un allèle est généralement notée (AA,Aa,aa).

Non. C'est ce qu'on apprend au lycée, parce que c'est facile, et parce que c'est ce que Mendel a élaboré pour les 7 traits qu'il a étudiés chez les plants de pois. La vraie vie est un parcelle plus complexe. La plupart des différences phénotypiques ne peuvent pas être expliquées en termes d'exactement deux allèles, dont l'un est classiquement dominant par rapport à l'autre.

Cela signifie qu'au lieu d'une paire A-T, vous obtenez une paire C-G sur aucune, 1 ou 2 copies.

Pas nécessairement. Deux allèles peuvent différer en de nombreux points de leur séquence.

Et vous semblez être un peu confus quant à la façon dont les gens écrivent la séquence d'ADN. Même si l'ADN est une double hélice, lorsque nous parlons de la séquence, nous ne nous référons qu'à un seul brin, comme celui-ci

GAGCCATGGGGGCGCCATGTTGCCACCAGCTGCCACGTGGCCTGGCTTTTGGTGCTGATCT

Une mutation peut transformer ce dernier T en A, mais nous ne disons pas "oh, rien ne s'est passé, c'est toujours une paire A-T" car il importe quel brin a quelle lettre.

Maintenant, que se passe-t-il exactement lorsque vous avez un tri-allèle (comme dans le groupe sanguin).

Eh bien, le groupe sanguin est plus compliqué que juste ABO… mais voici un assez vieux papier avec quelques détails utiles

http://www.ncbi.nlm.nih.gov/pubmed/2333095

"Nous présentons ici une base moléculaire pour les génotypes ABO. Les gènes A et B diffèrent par quelques substitutions de base unique, modifiant quatre résidus d'acides aminés qui peuvent entraîner des différences dans la spécificité de la transférase A et B. Une délétion critique d'une seule base a été trouvé dans le gène O, ce qui donne une protéine totalement différente, inactive, incapable de modifier l'antigène H."


Je ne suis pas sûr que vous ayez une très bonne compréhension de ce qu'est un allèle, alors laissez-moi bavarder un peu et voir si cela aide.

Le gène qui code pour l'enzyme qui place le type de glucides « A » sur un globule rouge est appelé l'allèle « IA » du gène. Ce gène a une longueur d'environ 1065 paires de bases. Si vous deviez l'épeler, cela ressemblerait à:

CAATGGCCGGGTAATTAAAATTGACGAC…

GTTACCGGCCCATTAATTTTAACTGCTG… (continuez à 1065 lettres)

L'allèle O le plus courant a la même série de paires de bases, sauf qu'une paire de bases (G_C) est perdue à la position 261. Il s'agit d'une mutation par délétion.

L'allèle B le plus courant est la même séquence génique, sauf qu'il y a sept substitutions de bases simples dans la séquence codante aux paires de bases 297, 526, 657, 703, 796, 803 et 930. Ce sont des mutations de substitution.

Cela a-t-il du sens? Le gène de base du groupe sanguin ABO est presque le même dans chaque allèle, mais présente de légers changements qui entraînent des phénotypes différents. Et c'est la version simple. Maintenant que nous pouvons facilement séquencer les gènes, nous pouvons regarder chez de nombreuses personnes et voir qu'il existe au moins VINGT séquences de gènes différentes avec de petits changements dans les paires de bases qui donnent toujours du sang de type "A". Vous pouvez voir une figure avec des exemples dans cet article : http://www.ncbi.nlm.nih.gov/pubmed/12014997 (open-source)

Ainsi, puisqu'un gène a des centaines de paires de bases, il y a souvent plus de deux, trois ou quatre allèles pour ce gène. Vous pouvez ajouter des paires de bases, les supprimer, les modifier, les échanger par morceaux à partir d'autres chromosomes - toutes sortes de choses se produisent.


Code génétique

Nos rédacteurs examineront ce que vous avez soumis et détermineront s'il faut réviser l'article.

Code génétique, la séquence de nucléotides dans l'acide désoxyribonucléique (ADN) et l'acide ribonucléique (ARN) qui détermine la séquence d'acides aminés des protéines. Bien que la séquence linéaire de nucléotides dans l'ADN contienne les informations pour les séquences de protéines, les protéines ne sont pas fabriquées directement à partir de l'ADN. Au lieu de cela, une molécule d'ARN messager (ARNm) est synthétisée à partir de l'ADN et dirige la formation de la protéine. L'ARN est composé de quatre nucléotides : adénine (A), guanine (G), cytosine (C) et uracile (U). Trois nucléotides adjacents constituent une unité appelée codon, qui code pour un acide aminé. Par exemple, la séquence AUG est un codon qui spécifie l'acide aminé méthionine. Il existe 64 codons possibles, dont trois ne codent pas pour les acides aminés mais indiquent la fin d'une protéine. Les 61 codons restants spécifient les 20 acides aminés qui composent les protéines. Le codon AUG, en plus de coder pour la méthionine, se trouve au début de chaque ARNm et indique le début d'une protéine. La méthionine et le tryptophane sont les deux seuls acides aminés codés par un seul codon (AUG et UGG, respectivement). Les 18 autres acides aminés sont codés par deux à six codons. Parce que la plupart des 20 acides aminés sont codés par plus d'un codon, le code est appelé dégénéré.

Le code génétique, autrefois considéré comme identique dans toutes les formes de vie, s'est avéré légèrement diverger dans certains organismes et dans les mitochondries de certains eucaryotes. Néanmoins, ces différences sont rares, et le code génétique est identique dans presque toutes les espèces, avec les mêmes codons spécifiant les mêmes acides aminés. Le déchiffrement du code génétique a été accompli par les biochimistes américains Marshall W. Nirenberg, Robert W. Holley et Har Gobind Khorana au début des années 1960.

Des triplets nucléotidiques (codons) spécifiant différents acides aminés sont indiqués dans le tableau.


Pour les étudiants et les enseignants

Pour les enseignants seulement

COMPRÉHENSION DURABLE
EVO-2
Les organismes sont liés par des lignes de descendance d'ascendance commune.

IST-1
Les informations héréditaires assurent la continuité de la vie.

OBJECTIF D'APPRENTISSAGE
EVO-2.A
Expliquez comment les processus et caractéristiques partagés, conservés et fondamentaux soutiennent le concept d'ascendance commune pour tous les organismes.

IST-1.I
Expliquez l'hérédité des gènes et des traits tels que décrits par les lois de Mendel.

CONNAISSANCES ESSENTIELLES
EVO-2.A.1
L'ADN et l'ARN sont porteurs d'informations génétiques.

EVO-2.A.2
Les ribosomes sont présents dans toutes les formes de vie.

EVO-2.A.3
Les principales caractéristiques du code génétique sont partagées par tous les systèmes vivants modernes.

EVO-2.A.4
Les voies métaboliques de base sont conservées dans tous les domaines actuellement reconnus.

IST-1.I.1
Les lois de ségrégation et d'assortiment indépendant de Mendel peuvent être appliquées à des gènes qui se trouvent sur des chromosomes différents.

IST-1.I.2
La fécondation implique la fusion de deux gamètes haploïdes, la restauration du nombre diploïde de chromosomes et l'augmentation de la variation génétique dans les populations en créant de nouvelles combinaisons d'allèles dans le zygote —

  1. Des règles de probabilité peuvent être appliquées pour analyser le passage de caractères monogéniques du parent à la progéniture.
  2. Le modèle de transmission (gènes monohybrides, dihybrides, liés au sexe et génétiquement liés) peut souvent être prédit à partir de données, y compris le pedigree, qui donnent le génotype/phénotype parent et les génotypes/phénotypes de la progéniture.

ÉQUATIONS PERTINENTES

Si A et B sont mutuellement exclusifs, alors :

Si A et B sont indépendants, alors :


Quelle est la différence entre un gène et un allèle ?

Un gène est une unité d'information héréditaire. Sauf dans certains virus, les gènes sont constitués d'ADN, une molécule complexe qui code l'information génétique pour la transmission des traits héréditaires. Les allèles sont également des séquences génétiques, et eux aussi codent pour la transmission des traits. Alors, quelle est la différence entre un gène et un allèle ?

La réponse courte est que un allèle est une variante d'un gène. Expliqué plus en détail, chaque gène réside à un locus spécifique (emplacement sur un chromosome) en deux copies, une copie du gène hérité de chaque parent. Les copies, cependant, ne sont pas nécessairement les mêmes. Lorsque les copies d'un gène diffèrent les unes des autres, elles sont appelées allèles. Un gène donné peut avoir plusieurs allèles différents, bien que seuls deux allèles soient présents au locus du gène chez un individu.

Les allèles peuvent parfois donner lieu à différents phénotypes (traits observables), certains allèles étant dominants (remplacent les traits d'autres allèles) ou, dans certains cas, plusieurs allèles agissant de manière codominante. Un exemple de ce dernier est le système de groupe sanguin ABO humain, dans lequel les personnes de type sanguin AB ont un allèle pour A et un pour B (les personnes sans aucun allèle sont de type O). Un exemple d'expression d'allèle dominant est la couleur des fleurs chez les plants de pois. Une plante à fleurs violettes a en fait un génotype (constitution génétique) constitué d'un gène à dominante P et un récessif p allèle.


Caractéristiques du code génétique

Triplet nature

Un code triplet pourrait créer un code génétique pour 64 combinaisons différentes (4 X 4 X 4) de code génétique et fournir de nombreuses informations dans la molécule d'ADN pour spécifier le placement des 20 acides aminés. Lorsque des expériences ont été effectuées pour déchiffrer le code génétique, il s'est avéré qu'il s'agissait d'un code en triplet. Ces codes à trois lettres de nucléotides (AUG, AAA, etc.) sont appelés codons.

Dégénérescence

Le code est dégénéré, ce qui signifie que le même acide aminé est codé par plus d'un triplet de bases. Par exemple, les trois acides aminés arginine, alanine et leucine ont chacun six codons synonymes.

Non chevauchement

Le code génétique ne se chevauche pas, c'est-à-dire que les codons adjacents ne se chevauchent pas. Un code sans chevauchement signifie que la même lettre n'est pas utilisée pour deux codons différents. En d'autres termes, aucune base ne peut participer à la formation de plus d'un codon.

Sans virgule

Il n'y a pas de signal pour indiquer la fin d'un codon et le début du suivant. Le code génétique est sans virgule (ou sans virgule).

Non-ambiguïté

Un codon particulier codera toujours pour le même acide aminé. Alors qu'un même acide aminé peut être codé par plus d'un codon (le code est dégénéré), le même codon ne doit pas coder pour deux ou plusieurs acides aminés différents (non ambigu).

Universalité

Bien que le code soit basé sur des travaux menés sur la bactérie Escherichia coli, il est valable pour d'autres organismes. Cette caractéristique importante du code génétique est appelée son universalité. Cela signifie que les mêmes séquences de 3 bases codent pour les mêmes acides aminés dans toutes les formes de vie, des simples micro-organismes aux organismes multicellulaires complexes tels que les êtres humains.

Polarité

Le code génétique a une polarité, c'est-à-dire que le code est toujours lu dans un sens fixe, c'est-à-dire dans le sens 5′ → 3′.

Codons d'initiation de la chaîne

Les triplés AUG et GUG jouent un double rôle dans E. coli. Lorsqu'ils se situent entre les deux extrémités d'un cistron (position intermédiaire), ils codent pour les acides aminés méthionine et valine, respectivement en position intermédiaire dans la molécule de protéine.

Codons de terminaison de chaîne

Les 3 triplets UAA, UAG, UGA ne codent pour aucun acide aminé. Ils étaient à l'origine décrits comme des codons non-sens, par rapport aux 61 autres codons, appelés codons sens.


Interactions alléliques

L'opération de l'hérédité mendélienne est souvent plus complexe que dans le cas des traits enregistrés par Mendel. En premier lieu, une dominance et une récessivité nettes ne sont en aucun cas toujours présentes. Lorsque des variétés à fleurs rouges et blanches de plantes à quatre heures ou de mufliers sont croisées, par exemple, le F1 les hybrides ont des fleurs de couleur rose ou rose intermédiaire, une situation qui semble plus explicable par la notion de mélange d'héritage que par les concepts mendéliens. Que l'hérédité de la couleur des fleurs est en effet due à des mécanismes mendéliens devient évident lorsque le F1 les hybrides sont autorisés à se croiser, donnant un F2 génération de plantes à fleurs rouges, roses et blanches dans un rapport de 1 rouge : 2 rose : 1 blanc. De toute évidence, les informations héréditaires pour la production de fleurs rouges et blanches n'avaient pas été mélangées dans la première génération d'hybrides, car les fleurs de ces couleurs étaient produites dans la deuxième génération d'hybrides.

Le mélange apparent dans le F1 génération s'explique par le fait que les allèles des gènes qui régissent la couleur des fleurs à quatre heures montrent une relation de dominance incomplète. Supposons alors qu'un allèle de gène R1 est responsable des fleurs rouges et R2 pour les blancs les homozygotes R1R1 et R2R2 sont respectivement rouges et blancs, et les hétérozygotes R1R2 avoir des fleurs roses. Un modèle similaire de manque de dominance se retrouve chez les bovins Shorthorn. Dans divers organismes, la dominance va de complète (un hétérozygote indiscernable de l'un des homozygotes) à incomplète (hétérozygotes exactement intermédiaires) à excessive ou surdominante (un hétérozygote plus extrême que l'un ou l'autre homozygote).

Une autre forme de dominance est celle dans laquelle l'hétérozygote présente les caractéristiques phénotypiques des deux allèles. C'est ce qu'on appelle la codominance, un exemple est observé dans le système de groupe sanguin MN des êtres humains. Le groupe sanguin MN est régi par deux allèles, M et N. Les personnes homozygotes pour le M allèle ont une molécule de surface (appelée antigène M) sur leurs globules rouges. De même, les homozygotes pour le N allèle ont l'antigène N sur les globules rouges. Les hétérozygotes—ceux avec les deux allèles—portent les deux antigènes.


Les rôles de l'ADN, des gènes, des allèles et des chromosomes dans l'héritage

Expliquez que l'information transmise des parents à la progéniture est transmise au moyen de gènes qui sont codés dans ADN molécules.

Expliquer le processus de base de ADN réplication.

Décrire les processus de base de la transcription et de la traduction.

Expliquez comment le croisement, le saut de gènes et la suppression et la duplication de gènes entraînent une variation génétique.

Expliquer comment mutation peut altérer l'information génétique et les conséquences possibles sur les cellules résultantes.

Utiliser des modèles moléculaires pour démontrer Mutation génétique et recombinaison au niveau moléculaire.

Décrivez comment le processus de méiose aboutit à la formation de gamètes haploïdes et analyse l'importance de méiose dans la reproduction sexuée.

Comparer et contraster la fonction de mitose et méiose.

Illustrer que le tri et la recombinaison des gènes dans la reproduction sexuée se traduisent par une grande variété de combinaisons de gènes possibles dans la progéniture.

Décrire la structure de base de ADN, y compris le rôle des liaisons hydrogène.

Expliquez comment le processus de ADN la réplication entraîne la transmission et la conservation du code génétique.

Décrire comment la transcription et la traduction entraînent l'expression des gènes.

Différencier les produits finaux de la réplication, de la transcription et de la traduction.

Citez des preuves pour soutenir que le code génétique est universel.

Décrivez comment les lois de ségrégation et d'assortiment indépendant de Mendel peuvent être observées à travers des modèles d'hérédité.

Distinguer les modèles héréditaires observés causés par plusieurs types de traits génétiques (dominant, récessif, codominant, lié au sexe, polygénique, dominance incomplète, allèles multiples)

Expliquez comment les processus de réplication, de transcription et de traduction sont similaires dans tous les organismes. Expliquez comment les actions des gènes, les modèles d'hérédité et la reproduction des cellules et des organismes expliquent la continuité de la vie.

Démontrer comment les caractéristiques héritées peuvent être observées aux niveaux moléculaire, cellulaire et de l'organisme.

Croissance et reproduction cellulaires

Objectifs

Dans cette unité, l'étudiant effectuera une révision complète de l'unité de génétique afin de préparer la fin de l'évaluation de l'unité. Les étudiants :

  • exprimer leur compréhension des résultats de la réplication, de la transcription et de la traduction de l'ADN.
  • décrivent le rôle de chacun dans la production de protéines : ADN, Gène, ARNm, ARNt, ARNr.
  • comparer la relation entre la séquence nucléotidique de l'ADN et la production de protéines.

Questions essentielles

Vocabulaire

  • Allèles : Formes de gènes responsables du contrôle du même trait différentes versions du même gène.
  • Acide aminé: Composé avec un groupe amino (&ndashNH2) à une extrémité et un groupe carboxyle (&ndashCOOH) à l'autre extrémité, le monomère pour les polypeptides et les protéines.
  • Anticodons : Séquence complémentaire de trois bases nucléotidiques sur l'ARNt qui code pour un acide aminé spécifique.
  • Règle d'appariement de base : Les appariements observés de bases azotées lorsque des brins d'ADN, d'ARN ou les deux s'apparient les uns aux autres. Dans l'ADN : la cytosine&ndashguanine et l'adénine&ndashthymine la thymine est remplacée par l'uracile dans l'ARN.
  • Chromatine : Substance constituée d'ADN et de protéines.
  • Codon : Séquence de trois bases nucléotidiques sur l'ARNm qui code pour un acide aminé spécifique.
  • Nucléotides complémentaires : Nucléotides qui s'apparient lorsque des brins d'ADN, d'ARN ou les deux s'apparient.
  • ADN : Acide nucléique double brin qui contient les informations génétiques nécessaires à la croissance, à la division et à la fonction des cellules.
  • Allèle dominant : Allèle qui s'exprime toujours lorsqu'il est présent chez un individu.
  • Épistase : L'interaction entre les gènes à deux ou plusieurs loci, de sorte que le phénotype diffère de ce qui serait attendu si les loci étaient exprimés indépendamment.
  • Gène: L'unité fondamentale, physique et fonctionnelle de l'hérédité.
  • La génétique: L'étude des modèles d'hérédité de traits spécifiques.
  • Génotype: La constitution génétique d'un organisme.
  • Hémoglobine: Composant à base de protéines des globules rouges qui est principalement responsable du transport des poumons vers les tissus du corps.
  • Hérédité: La transmission de facteurs génétiques du parent à la progéniture.
  • Hétérozygote : Avoir des allèles différents qui codent pour le même gène ou trait.
  • Homozygote : Avoir deux allèles identiques qui codent pour le même trait.
  • Dominance incomplète: Caractéristiques dans lesquelles l'hétérozygote présente un phénotype différent du phénotype dominant homozygote.
  • Lieu: L'emplacement d'un gène, ou d'une séquence de gènes, sur un chromosome pluriel: lieux.
  • ARN messager (ARNm) : Molécule simple brin d'ARN qui contient les instructions pour la synthèse des protéines.
  • Mutation: Modification du matériel génétique résultant d'une erreur de réplication de l'ADN. Les mutations peuvent être bénéfiques, nuisibles ou neutres.
  • Bases azotées : Composés contenant de l'azote qui sont des composants de l'ADN et de l'ARN. Il y a quatre bases azotées dans l'ADN : la cytosine, la guanine, l'adénine et la thymine (remplacée par l'uracile dans l'ARN).
  • Nucléotide : Élément de base des acides nucléiques, tels que l'ADN et l'ARN. Composé organique composé d'une base azotée, d'un sucre et d'un groupe phosphate.
  • Phénotype : Les caractéristiques physiques d'un organisme.
  • Polygénique : Traits dans lesquels plusieurs gènes contribuent au phénotype global.
  • Polypeptide : Toute macromolécule organique constituée d'acides aminés. Contient du carbone, de l'hydrogène, de l'oxygène et de l'azote.
  • Protéine: Molécule organique constituée d'un ou plusieurs polypeptides remplissant une fonction spécifique.
  • Place Punnett : Diagramme de probabilité illustrant la progéniture possible d'un accouplement.
  • Récessif: Avoir des allèles différents qui codent pour le même gène ou trait.
  • Allèle récessif : Allèle qui n'est exprimé que lorsque l'allèle dominant d'un trait n'est pas présent.
  • Réplication : Processus par lequel une cellule copie son ADN.
  • ARN ribosomique (ribosome) : Molécule sphérique constituée d'une protéine et d'un ARNr, site de synthèse des protéines.
  • ARN polymérase : Enzyme ARN qui synthétise l'ARN à partir de la séquence d'ADN dans le noyau.
  • L'anémie falciforme: Maladie génétique autosomique récessive dans laquelle certains globules rouges prennent une forme anormale.
  • Trait: Une caractéristique spécifique qui varie d'un individu à l'autre.
  • Transcription: Le processus qui code l'ARNm avec une séquence complémentaire de nucléotides de l'ADN.
  • ARN de transfert (ARNt) : Molécule simple brin d'ARN qui transfère un acide aminé spécifique au ribosome et à l'ARNm lors de la synthèse des protéines.
  • Traduction: Le processus qui lit les instructions de l'ARNm et produit une séquence d'acides aminés.
  • Triolet: Séquence de trois bases nucléotidiques sur l'ADN qui code pour un acide aminé spécifique.

Durée

Compétences préalables

Matériaux

  • Matériel de préparation de l'enseignant et ndashDu gène à la protéine (S-B-5-3_Document de préparation de l'enseignant.pdf)
  • Du gène à la protéine&ndashStudent Handout (S-B-5-3_From Gene to Protein Student Handout.doc)
  • Du gène à la protéine et aux questions des étudiants (S-B-5-3_From Gene to Protein Student Questions.doc)
  • Clé de réponse du gène à la protéine (S-B-5-3_From Gene to Protein KEY.doc)
  • Matériaux de procédure de modélisation (S-B-5-3_Matériaux de procédure de modélisation - Du gène à la protéine.pdf)
  • Modèle de bordereau de sortie et jours 1 et 2 (S-B-5-3_Modèle de bordereau de sortie 1 et 2 jours.doc)
  • Modèle de bordereau de sortie et jours 3 et 4 (S-B-5-3_Exit Slip-Days 3 et 4 Template.doc)
  • Chanson d'héritage génétique/rubrique de rap (S-B-5-3_Chanson d'héritage génétique ou rubrique de rap.docx)
  • affiche ou papier graphique, un par groupe
  • papier copie couleur (x3 couleurs)
  • ruban adhésif transparent
  • marqueur, un par groupe
  • notes des élèves des leçons 1 et 2

Unités connexes et plans de cours

Matériaux et ressources connexes

L'inclusion possible de sites Web commerciaux ci-dessous n'est pas une approbation implicite de leurs produits, qui ne sont pas gratuits et ne sont pas requis pour ce plan de cours.

  • Matériel de préparation de l'enseignant et ndashDu gène à la protéine (S-B-5-3_Document de préparation de l'enseignant.pdf)
  • Du gène à la protéine&ndashStudent Handout (S-B-5-3_From Gene to Protein Student Handout.doc)
  • Du gène à la protéine et aux questions des étudiants (S-B-5-3_From Gene to Protein Student Questions.doc)
  • Clé de réponse du gène à la protéine (S-B-5-3_From Gene to Protein KEY.doc)
  • Matériaux de procédure de modélisation (S-B-5-3_Matériaux de procédure de modélisation - Du gène à la protéine.pdf)
  • Modèle de bordereau de sortie et jours 1 et 2 (S-B-5-3_Modèle de bordereau de sortie 1 et 2 jours.doc)
  • Modèle de bordereau de sortie et jours 3 et 4 (S-B-5-3_Exit Slip-Days 3 et 4 Template.doc)
  • Chanson d'héritage génétique/rubrique de rap (S-B-5-3_Chanson d'héritage génétique ou rubrique de rap.docx)
  • affiche ou papier graphique, un par groupe
  • papier copie couleur (x3 couleurs)
  • ruban adhésif transparent
  • marqueur, un par groupe
  • notes des élèves des leçons 1 et 2

L'évaluation formative

  • Évaluez les réponses des élèves pendant le travail de groupe pour une compréhension générale de la traduction par rapport à la transcription.
  • Recueillez les questions des étudiants pour une évaluation individuelle.
  • Incorporer l'auto-évaluation des étudiants par le biais des bordereaux/tickets de sortie à la fin de chaque leçon.

Supports pédagogiques suggérés

Échafaudage, engagement actif, modélisation, instruction explicite
W : Dans cette leçon, les élèves synthétisent ce qu'ils ont appris sur le patrimoine génétique en écrivant une chanson ou un rap.
H : La leçon s'ouvre sur un examen du contenu des leçons 1 et 2. Si possible, jouez l'un des raps génétiques de la section Ressources connexes pour attirer l'attention des élèves.
E : En écrivant la chanson/le rap, les élèves se préparent aux évaluations des unités sommatives.
R : Les élèves revisitent le contenu des leçons 1 et 2 pendant la séance de remue-méninges et pendant qu'ils écrivent la chanson/le rap.
E : Les élèves peuvent utiliser la rubrique pour s'auto-évaluer pendant qu'ils écrivent la chanson/le rap. Ils expriment leurs compréhensions par écrit et éventuellement en présentant leur travail à la classe.
T : Cette leçon peut être adaptée en présentant des exemples d'autres chansons et raps génétiques avant que les élèves ne commencent à travailler. Les élèves peuvent également être placés dans des groupes à capacités mixtes pour l'activité.
O : La leçon commence par des questions de révision et une séance de remue-méninges avant que les étudiants ne réalisent une activité dans laquelle ils créent un modèle papier des processus de transcription et de traduction, puis répondent à des questions de suivi.

Procédures d'instruction

Préparation:

  • Lisez la section Biologie de base et suggestions de discussion aux pages deux à quatre dans le Matériel de préparation de l'enseignant &ndashFrom Gene to Protein (S-B-5-3_Teacher Preparation Document.pdf). Ces connaissances de base aideront à guider les étudiants dans la réponse aux questions des étudiants et les activités de modélisation.
  • Créez un paquet de matériaux de procédure de modélisation pour les étudiants (S-B-5-3_Matériaux de procédure de modélisation - Du gène à la protéine.pdf). Chaque paire d'élèves aura besoin du matériel suivant :

o Molécule d'ADN (&ldquoBeginning of Hemoglobin Gene&rdquo) sur papier de couleur (découper le gabarit en bandes horizontales)

o &ldquoSecond Part of mRNA&rdquo strip et 9 RNA nucleotides, coupés individuellement, sur un papier de couleur différente. (Chaque paquet doit avoir 1A, 2C, 3G et 3U.)

o 6 molécules d'ARNt sur le même papier de couleur que les nucléotides d'ARN (coupez chaque rectangle d'ARNt pour inclure trois nucléotides sous les mots &ldquoAmino Acid&rdquo un chacun des six types d'ARNt par paquet)

o 6 noms d'acides aminés sur un papier de couleur différente (un de chaque acide aminé par sachet : leucine, histidine, valine, thréonine, proline, et acide glutamique)

Dire, &ldquoDans cette leçon, nous allons rassembler tout ce que nous avons appris au cours des deux dernières leçons. Nous avons commencé cette unité en examinant le travail de Gregor Mendel et les expériences qu'il a faites avec des plants de pois. De cela, nous avons appris quelques principes de base de l'héritage.&rdquo

&ldquoQuelqu'un peut-il résumer le travail de Mendel&rsquo et comment il se rapporte à l'héritage ?&rdquo (Laissez aux élèves le temps de répondre.)

&ldquoÀ partir des travaux de Mendel&rsquo, nous avons examiné de plus près la réplication de l'ADN. Qu'est-ce que la réplication de l'ADN a à voir avec l'hérédité génétique ?&rdquo (Laissez aux élèves le temps de répondre.)

Pendant que les élèves rassemblent leur matériel, écrivez les questions suivantes au tableau et laissez aux élèves le temps de consulter un autre élève pour trouver les réponses.

2. Les instructions pour fabriquer une protéine sont fournies par un gène, qui est un segment spécifique d'une molécule _____.

Passez en revue les réponses et répondez aux questions des élèves avant de continuer.

1. Une protéine est un long train d'acides aminés liés entre eux. Les protéines ont différentes fonctions, elles peuvent fournir une structure (ligaments, ongles, cheveux), aider à la digestion (enzymes gastriques), aider au mouvement (muscles) et jouer un rôle dans notre capacité à voir (le cristallin de nos yeux est une protéine cristalline pure ).

Demandez aux élèves de lire les pages 1&ndash2 du document de l'élève et de répondre aux questions 1&ndash7 avec leur partenaire.

Une fois qu'ils ont terminé, expliquez aux élèves qu'ils utiliseront des modèles papier pour en savoir plus sur la transcription et la traduction. Ils modéliseront comment une cellule effectue la transcription et la traduction pour former le début de la molécule d'hémoglobine. Expliquez que l'hémoglobine est un composant à base de protéines des globules rouges qui est principalement responsable du transport des poumons vers les tissus du corps. Distribuez ce qui suit à chaque paire d'élèves :

  • Modeling Procedure Materials Packet, comme décrit dans la section Préparation de cette leçon (voir S-B-5-3_Modeling Procedure Materials-From Gene to Protein dans le dossier Resources)
  • ruban
  • paire de ciseaux

Passez en revue le concept d'appariement de base abordé dans la deuxième leçon.

Expliquez qu'un processus d'appariement de bases similaire a lieu dans la transcription, mais au lieu de l'appariement A&ndashT trouvé dans l'ADN, dans la transcription, l'adénine de base s'apparie avec l'uracile trouvé dans l'ARN.

Dites aux élèves que vous les guiderez tout au long du processus de transcription comme suit : Les élèves travailleront avec des partenaires pour modéliser la séquence réelle d'étapes utilisée par la cellule pour effectuer la transcription. Dites aux élèves que même s'ils seront capables de penser à un moyen plus rapide de fabriquer l'ARNm, ils doivent suivre la séquence d'étapes décrite dans leurs documents afin d'apprendre comment la cellule fabrique réellement l'ARNm.

Demandez à chaque paire d'élèves de remplir la Procédure de modélisation de la transcription de leurs documents à la page 3. Observez les paires pour vous assurer que les élèves suivent correctement les procédures et utilisent le matériel de manière appropriée. Une fois qu'ils ont terminé les procédures de modélisation de la transcription, demandez aux élèves de revoir leurs réponses dans le document de questions. L'examen des réponses des élèves pour la rigueur et l'exactitude peut montrer quels élèves ont une bonne compréhension du concept et quels élèves peuvent avoir besoin d'un soutien supplémentaire.

Circulez dans la classe en assistant les groupes qui ont besoin d'aide.

Demandez aux élèves de résumer ce qu'ils ont appris en expliquant comment un gène dirige la synthèse d'une molécule d'ARNm. Ils répondront sur un bordereau de sortie (S-B-5-3_Exit Slip-Days 1 et 2 Template.doc). Demandez aux élèves de résumer ce qu'ils ont appris en expliquant comment un gène dirige la synthèse d'une molécule d'ARNm. Dites aux élèves d'inclure dans leur explication les mots et expressions : règle d'appariement de base, nucléotides complémentaires, et cytoplasme.

Commencez par permettre aux élèves de partager les réponses à la question du bordereau de sortie donnée à la fin du dernier cours. Ensemble, les élèves partageront les meilleures réponses et sélectionneront les réponses les plus appropriées à la question.

Informez les élèves qu'ils modéliseront ensuite le processus de traduction. Demandez aux élèves de revoir le contenu précédemment couvert sur la traduction. Commencez à clarifier les concepts de la traduction. Demandez aux élèves volontaires d'examiner le contenu et de commencer la discussion en classe pour clarifier les concepts. Lorsque vous avez déterminé que les étudiants sont prêts à aller de l'avant, ils peuvent commencer la Procédure de modélisation de la traduction aux pages 5&ndash7 de leurs polycopiés.

  • Demandez aux élèves de retourner en groupes à partir du jour 1.
  • Demandez aux étudiants de lire les pages 3 et 4 du document de l'étudiant, puis de suivre la procédure de modélisation de la traduction.
  • Surveillez activement les groupes d'étudiants pendant qu'ils exécutent la procédure, en répondant aux questions au besoin.

Rassemblez la classe et demandez aux élèves de travailler sur toutes les questions restantes dans leur document de questions.

Une fois que les étudiants ont répondu aux questions, ils peuvent recevoir un ticket de sortie à remplir et à remettre avant de partir (S-B-5-3_Exit Slip-Days 3 et 4 Template.doc).

Demandez aux élèves de résumer ce qu'ils ont appris en expliquant comment un gène dirige la synthèse d'une protéine. Les élèves doivent inclure dans leur explication les mots acide aminé, anti-codon, codons, cytoplasme, ADN, ARNm, nucléotide, noyau, ribosome, ARN polymérase, ARNt, transcription, et Traduction.

Placez les élèves en petits groupes et donnez à chaque groupe une affiche ou une feuille de papier et un marqueur. Demandez à chaque groupe d'élèves de réfléchir au vocabulaire et aux concepts des leçons 1 et 2 et de les noter sur l'affiche. Ils peuvent écrire des mots, des expressions, des phrases et/ou inclure des diagrammes ou des images sur l'affiche.

Dites aux élèves, &ldquoVous allez écrire une chanson ou un rap sur l'héritage génétique. Vous pouvez utiliser les idées sur votre affiche et vos notes pour vous aider. Votre chanson/rap doit expliquer clairement les rôles de l'ADN, des allèles, des gènes et des chromosomes dans l'héritage. Il devrait inclure des informations sur le travail de Mendel et également sur la réplication de l'ADN.

Créez et donnez aux élèves une copie de la chanson sur l'héritage génétique/rubrique de rap et lisez-la avec eux (S-B-5-3_chanson d'héritage génétique ou rubrique de rap.docx). Répondez aux questions des élèves avant de commencer.

Demandez aux élèves de travailler seuls ou en groupes pour écrire la chanson ou le rap. Si le temps le permet, demandez à plusieurs élèves de présenter leurs chansons à la classe.


Que signifie l'expression « le code génétique universel » ? Expliquez ce que cela signifie en utilisant deux êtres vivants uniques et ce qu'ils ont en commun.

"1. it should be, it has been for about 20 years, and it's really not much different in the end than breeding animals to have particular traits. there are always concerns about genetically engineered animals/plants affecting the environment in unexpected negative ways, but i can't think of an example where the fears didn't turn out to be baseless.

first, as you point out, it would be a great advance in pharmacology, to be able to tailor drugs and their doses to me. the pros involve better medical treatment. the cons involve privacy issues like insurance companies denying coverage to people with genetic risk factors. looking at dna markers wouldn't affect the frequency of genetic diseases, but it would allow detection of them earlier. and ok, actually i suppose that if people used this information to avoid having children with genetic diseases, some might decrease in frequency."


IB Biology/Genetics

Sex linkage is the association of a characteristic with gender, because the gene controlling the characteristic is located on a sex chromosome.

State two examples of sex-linkage

Color blindness and hemophilia- both these conditions are produced by a recessive sex-linked allele on the X chromosome.

State that a human female can be homozygous or heterozygous with respect to to sex-linkage genes.

Explain that female carriers are heterozygous for X-linked recessive alleles

Calculate and predict the genotypic and phenotypic ratio of offspring of monohybrid crosses involving any of the above patterns of inheritance

Deduce the genotypes or phenotypes of individuals in pedigree charts

3.4 Genetic Engineering and Other Aspects of Biotechnology Edit

State that PCR (Polymerase Chain Reaction) copies and amplifies minute quantities of nucleic acid.

State that gel electrophoresis involves the separation of fragmented pieces of DNA according to their charge and size.

  • Based on idea that molecules move at different rates (and directions) when placed in an electric field due to different charges and sizes.

State that gel electrophoresis of DNA is used in DNA profiling.

Describe two applications of DNA profiling.

  • Paternity suits (determining parent-child relationships).
  • Criminal investigations (using blood or semen collected from the scene).
  • Identification of people long dead (e.g. Egyptian mummies, Russian Tsars).
  • Everyone's DNA is unique and so can be used in identification however, samples can be contaminated.

Define genetic screening.

Discuss three advantages and/or disadvantages of genetic screening.

  • Advantages include: Checking unborn babies for genetic disorders, can gain knowledge about one's own genotype.
  • Disadvantages include: Ethical issues (e.g. selection, abortion(?))

State that the Human Genome Project is an international cooperative venture established to sequence the complete human genome.

  • The human genome has 30,000 to 40,000 genes. The HGP is attempting to find the location of all these genes and their base sequence.

Describe two advantageous outcomes of this project

  • Easier to study how genes control human development.
  • Allow identification of genetic diseases and allow for the production of a drug based on the normal DNA sequences of genes.

State that genetic material can be transferred between species because the genetic code is universal

  • The genetic code is universal. This means that genes can be transfered from one organism to another, (and this has indeed been the case). Organisms that have had genes transferred to them are called genetically modified organisms.

Outline the basic technique for gene transfer involving plasmids, a host cell (bacterium, yeast or other cell) restriction enzymes (endonucleases) and DNA ligase.

  1. Messenger RNA coded for insulin is extracted from human pancreas cells.
  2. DNA copies of the messenger RNA coding for insulin are made using the enzyme reverse transcriptase.
  1. Plasmids: are small loops of DNA found in bacteria.
  2. Plasmids are cut open using restriction enzyme endonucleouse.
  3. The insulin gene and the plasmid are mixed.
  1. DNA ligase seals up the plasmid.
  2. The plasmid with the human insulin gene is inserted into a recombinant plasmid.
  3. The recombinant plasmid are mixed with a strain of E.Coli bacteria.
  4. The E.coli bacteria start to make insulin which is then extracted, purified and used by patients suffering from diabities.

State two examples of the current uses of genetically modified crops or animals

  • Golden rice is a genetically modified rice crop that produces beta-carotene, which can be metabolized into Vitamin A within the body. Scientists hope that golden rice will eventually be a cheap source of beta-carotene in malnourished countries, reducing the number of children worldwide that go blind from Vitamin A deficiency.
  • Bt maize is a genetically modified corn crop that produces a toxin that kills European corn borers feeding on the maize.

Discuss the potential benefits and potential harmful effects of one example of genetic modificiation

  • Bt Maize: Contains a gene which releases toxin that kills insects feeding on the maize.
  • Avantages: Less pest damage, and therefore better harvests.
  • Désavantages: Humans or animals that eat BT Maize might be harmed by bacterial DNA in it.

Outline the process of gene therapy using a named example

  • Gene Therapy: is the treatment of a genetic disease by altering the genotype. It is is still very experimental. However, if the allele of a gene is recessive, then perhaps the dominant gene could be inserted to prevent that disease. SCID (Severe combined immune deficiency) is caused by lack of the enzyme ADA. It produces lymphocytes, without it, the body cannot fight diseases. The gene causing SCID is recessive.
  1. Genetic screening shows a baby has SCID.
  2. The gene that codes for ADA is obtained. The gene is inserted into a retrovirus.
  3. The retrovirus is mixed with stem cells. They enter and insert the gene into the stem cell's chromosomes.
  4. Stem cells containing ADA are injected back into the baby's blood stream.

"SCID-ADA-l(ymphcytes)" / "skedaddle"

  • UNE cloner is a group of genetically identical organisms or a group of genetically identical cells derived from a single parent.

Outline the technique for cloning using differentiated cells

    Udder cells are taken from a donor sheep. The genes in the cell are made dormant.


Contenu

Genetic diversity is the variability of genes in a species. A number of means can express the level of genetic diversity: observed heterozygosity, expected heterozygosity, the mean number of alleles per locus, or the percentage of polymorphic loci.

Genetic diversity determines the potential fitness of a population and ultimately its long-term persistence, because genes encode phenotypic information. Extinction risk has been associated with low genetic diversity and several researchers have documented reduced fitness in populations with low genetic diversity. For example, low heterozigosity has been associated with low juvenile survival, reduced population growth, low body size, and diminished adult lifespan. [1] [2] [5] [6] [7]

Heterozygosity, a fundamental measurement of genetic diversity in population genetics, plays an important role in determining the chance of a population surviving environmental change, novel pathogens not previously encountered, as well as the average fitness of a population over successive generations. Heterozygosity is also deeply connected, in population genetics theory, to population size (which itself clearly has a fundamental importance to conservation). All things being equal, small populations will be less heterozygous – across their whole genomes – than comparable, but larger, populations. This lower heterozygosity (i.e. low genetic diversity) renders small populations more susceptible to the challenges mentioned above.

In a small population, over successive generations and without gene flow, the probability of mating with close relatives becomes very high, leading to inbreeding depression – a reduction in fitness of the population. The reduced fitness of the offspring of closely related individuals is fundamentally tied to the concept of heterozygosity, as the offspring of these kinds of pairings are, by necessity, less heterozygous (more homozygous) across their whole genomes than outbred individuals. A diploid individual with the same maternal and paternal grandfather, for example, will have a much higher chance of being homozygous at any loci inherited from the paternal copies of each of their parents' genomes than would an individual with unrelated maternal and paternal grandfathers (each diploid individual inherits one copy of their genome from their mother and one from their father).

High homozygosity (low heterozygosity) reduces fitness because it exposes the phenotypic effects of recessive alleles at homozygous sites. Selection can favour the maintenance of alleles which reduce the fitness of homozygotes, the textbook example being the sickle-cell beta-globin allele, which is maintained at high frequencies in populations where malaria is endemic due to the highly adaptive heterozygous phenotype (resistance to the malarial parasite Plasmodium falciparum).

Low genetic diversity also reduces the opportunities for chromosomal crossover during meiosis to create new combinations of alleles on chromosomes, effectively increasing the average length of unrecombined tracts of chromosomes inherited from parents. This in turn reduces the efficacy of selection, across successive generations, to remove fitness-reducing alleles and promote fitness-enhancing allelels from a population. (A simple hypothetical example would be two adjacent genes – A and B – on the same chromosome in an individual. If the allele at A promotes fitness "one point", while the allele at B reduces fitness "one point", but the two genes are inherited together, then selection cannot favour the allele at A while penalising the allele at B – the fitness balance is "zero points". Recombination can swap out alternative alleles at A and B, allowing selection to promote the optimal alleles to the optimal frequencies in the population – but only if there are alternative alleles to choose between!)

The fundamental connection between genetic diversity and population size in population genetics theory can be clearly seen in the classic population genetics measure of genetic diversity, the Watterson estimator, in which genetic diversity is measured as a function of effective population size and mutation rate. Given the relationship between population size, mutation rate, and genetic diversity, it is clearly important to recognise populations at risk of losing genetic diversity before problems arise as a result of the loss of that genetic diversity. Once lost, genetic diversity can only be restored by mutation and gene flow. If a species is already on the brink of extinction there will likely be no populations to use to restore diversity by gene flow, and any given population will (by definition) be small and therefore diversity will accumulate in that population by mutation much more slowly than it would in a comparable, but bigger, population (since there are fewer individuals whose genomes are mutating in a smaller population than a bigger population).

    and inbreeding depression. [8][9]
  1. The accumulation of deleterious mutations[10]
  2. A decrease in frequency of heterozygotes in a population, or heterozygosity, which decreases a species' ability to evolve to deal with change in the environment [11][12][13] uncertainties, which can lead to a reprioritization of conservation efforts [14] as the main evolutionary process, instead of natural selection
  3. Management units within species
  4. Hybridization with allochthonous species, with the progressive substitution of the initial endemic species.

Specific genetic techniques are used to assess the genomes of a species regarding specific conservation issues as well as general population structure. [15] This analysis can be done in two ways, with current DNA of individuals or historic DNA. [16]

Techniques for analysing the differences between individuals and populations include

These different techniques focus on different variable areas of the genomes within animals and plants. The specific information that is required determines which techniques are used and which parts of the genome are analysed. For example, mitochondrial DNA in animals has a high substitution rate, which makes it useful for identifying differences between individuals. However, it is only inherited in the female line, and the mitochondrial genome is relatively small. In plants, the mitochondrial DNA has very high rates of structural mutations, so is rarely used for genetic markers, as the chloroplast genome can be used instead. Other sites in the genome that are subject to high mutation rates such as the major histocompatibility complex, and the microsatellites and minisatellites are also frequently used.

These techniques can provide information on long-term conservation of genetic diversity and expound demographic and ecological matters such as taxonomy. [15]

Another technique is using historic DNA for genetic analysis. Historic DNA is important because it allows geneticists to understand how species reacted to changes to conditions in the past. This is a key to understanding the reactions of similar species in the future. [16]

Techniques using historic DNA include looking at preserved remains found in museums and caves. [17] Museums are used because there is a wide range of species that are available to scientists all over the world. The problem with museums is that, historical perspectives are important because understanding how species reacted to changes in conditions in the past is a key to understanding reactions of similar species in the future. [17] Evidence found in caves provides a longer perspective and does not disturb the animals. [17]

Another technique that relies on specific genetics of an individual is noninvasive monitoring, which uses extracted DNA from organic material that an individual leaves behind, such as a feather. [17] This too avoids disrupting the animals and can provide information about the sex, movement, kinship and diet of an individual. [17]

Other more general techniques can be used to correct genetic factors that lead to extinction and risk of extinction. For example, when minimizing inbreeding and increasing genetic variation multiple steps can be taken. Increasing heterozygosity through immigration, increasing the generational interval through cryopreservation or breeding from older animals, and increasing the effective population size through equalization of family size all helps minimize inbreeding and its effects. [18] Deleterious alleles arise through mutation, however certain recessive ones can become more prevalent due to inbreeding. [18] Deleterious mutations that arise from inbreeding can be removed by purging, or natural selection. [18] Populations raised in captivity with the intent of being reintroduced in the wild suffer from adaptations to captivity. [19]

Inbreeding depression, loss of genetic diversity, and genetic adaptation to captivity are disadvantageous in the wild, and many of these issues can be dealt with through the aforementioned techniques aimed at increasing heterozygosity. In addition creating a captive environment that closely resembles the wild and fragmenting the populations so there is less response to selection also help reduce adaptation to captivity. [20]

Solutions to minimize the factors that lead to extinction and risk of extinction often overlap because the factors themselves overlap. For example, deleterious mutations are added to populations through mutation, however the deleterious mutations conservation biologists are concerned with are ones that are brought about by inbreeding, because those are the ones that can be taken care of by reducing inbreeding. Here the techniques to reduce inbreeding also help decrease the accumulation of deleterious mutations.

These techniques have wide-ranging applications. One application of these specific molecular techniques is in defining species and sub-species of salmonids. [15] Hybridization is an especially important issue in salmonids and this has wide-ranging conservation, political, social and economic implications. In Cutthroat Trout mtDNA and alloenzyme analysis, hybridization between native and non-native species was shown to be one of the major factors contributing to the decline in their populations. This led to efforts to remove some hybridized populations so native populations could breed more readily. Cases like these impact everything from the economy of local fishermen to larger companies, such as timber. Specific molecular techniques led to a closer analysis of taxonomic relationships, which is one factor that can lead to extinctions if unclear.

New technology in conservation genetics has many implications for the future of conservation biology. At the molecular level, new technologies are advancing. Some of these techniques include the analysis of minisatellites and MHC. [15] These molecular techniques have wider effects from clarifying taxonomic relationships, as in the previous example, to determining the best individuals to reintroduce to a population for recovery by determining kinship. These effects then have consequences that reach even further. Conservation of species has implications for humans in the economic, social, and political realms. [15] In the biological realm increased genotypic diversity has been shown to help ecosystem recovery, as seen in a community of grasses which was able to resist disturbance to grazing geese through greater genotypic diversity. [21] Because species diversity increases ecosystem function, increasing biodiversity through new conservation genetic techniques has wider reaching effects than before.


Voir la vidéo: Bio 1 - Chapitre 4 - Allèles multiples (Février 2023).